ID: 1061357810

View in Genome Browser
Species Human (GRCh38)
Location 9:130119565-130119587
Sequence ATTCCAACTCTGCTGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061357810_1061357813 5 Left 1061357810 9:130119565-130119587 CCAGTGAGCAGCAGAGTTGGAAT 0: 1
1: 1
2: 4
3: 35
4: 284
Right 1061357813 9:130119593-130119615 CCCAGGATGTTCAGTCGTGCAGG No data
1061357810_1061357815 6 Left 1061357810 9:130119565-130119587 CCAGTGAGCAGCAGAGTTGGAAT 0: 1
1: 1
2: 4
3: 35
4: 284
Right 1061357815 9:130119594-130119616 CCAGGATGTTCAGTCGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061357810 Original CRISPR ATTCCAACTCTGCTGCTCAC TGG (reversed) Intronic
900593038 1:3468280-3468302 ATTCGTGCTCTGCTCCTCACTGG - Intronic
901463274 1:9404390-9404412 GCTCCAACCCTGCTGCTCCCTGG - Intergenic
901639205 1:10684916-10684938 CTCCCAACTCAGCTGCCCACGGG + Intronic
902468474 1:16631986-16632008 GTCCCAACTCTCCTGCTTACTGG + Intergenic
902780857 1:18703917-18703939 ATCCCAGCTCTACTGCTCAGGGG + Intronic
903032079 1:20471164-20471186 ATCCCAACTCTGCCACTTACTGG - Intergenic
903287575 1:22286434-22286456 ATCCCAGCCCTGCTGCTCCCGGG - Intergenic
903449691 1:23444475-23444497 ATACAAACTCTGCTGCTTGCTGG + Intronic
903550805 1:24156494-24156516 ATCCCAGCTCTGCTGTTCACTGG - Exonic
903571534 1:24309174-24309196 GTTCCAGCTCTGCTGCTTGCTGG - Intergenic
906802333 1:48748998-48749020 ATTTCAACTCTGCTGCTCTGTGG - Intronic
907820303 1:57960978-57961000 ATTCCAGCTCAGCTACTTACTGG + Intronic
908931499 1:69321530-69321552 AGGCCACCTCTGCTGCACACAGG - Intergenic
910114416 1:83716531-83716553 TGTCCAACTCTGCTGCTTACCGG - Intergenic
911221391 1:95251245-95251267 AATACAACTATGCTGATCACTGG + Intergenic
912566571 1:110591956-110591978 ATCCCAACTCTGTCACTCACCGG - Intergenic
913172154 1:116242876-116242898 GTTCCAACTCTGCTACACCCAGG + Intergenic
913225534 1:116695163-116695185 ATTGCAACTGTGCTGCTGCCTGG + Intronic
915842121 1:159222339-159222361 ATCCCAACTCTGCTACTTATTGG + Intergenic
917494372 1:175526755-175526777 ATTCAAACCCAGGTGCTCACAGG - Intronic
918705014 1:187649302-187649324 TTTCCATCTGTGCTGCTCCCAGG - Intergenic
919356956 1:196536586-196536608 CTTGCAACTCTGCTGCTAAGGGG + Intronic
919782373 1:201229211-201229233 CCTCCAGCCCTGCTGCTCACAGG - Intergenic
920968774 1:210724358-210724380 ATCCTAACTCTACTGCTTACTGG - Intronic
921210242 1:212889813-212889835 ATTCCGATTCTGTTGCTCAGTGG + Intronic
921752565 1:218813429-218813451 ATTCAAGCTTTGCTGCTTACTGG - Intergenic
924106478 1:240654318-240654340 CCTCCGACTCTGCAGCTCACTGG - Intergenic
1062819189 10:521501-521523 GTCCCAGCCCTGCTGCTCACTGG + Intronic
1063394555 10:5674873-5674895 ATTCCAATTATGCCACTCACTGG - Intergenic
1065417544 10:25504569-25504591 ATCTCAACTCTGCTGCCCGCTGG + Intronic
1067905709 10:50288580-50288602 ATCCCAACTCTACTGTTTACAGG - Intergenic
1068912202 10:62390133-62390155 ATTCTTACTCTGCTTCTGACTGG + Intronic
1069143719 10:64862054-64862076 ATTCCAAGTGTGCTGTTCAGTGG - Intergenic
1069431178 10:68335817-68335839 ATCCCTACTCTGCCACTCACTGG - Intronic
1070160082 10:73861257-73861279 ATCCCAGCTCTGCTGCTCACTGG - Intronic
1071861963 10:89683458-89683480 ATTCCATCTCTGCTGCCCCTGGG + Intergenic
1074161938 10:110842755-110842777 ATCCCAACTCTGCCACTTACTGG - Intergenic
1074549514 10:114429551-114429573 ATTCTAGCTCTGCTGCTCACTGG + Intergenic
1075203537 10:120426495-120426517 ATTCCAGCTCGGCAGCTCAGAGG - Intergenic
1075518224 10:123126680-123126702 ATTCCAACTCTGCCACTTACAGG - Intergenic
1077257758 11:1596358-1596380 ATTCCCACTCTGCTCTTCCCTGG + Intergenic
1078902415 11:15653747-15653769 ATTCCAGCTCTGATATTCACTGG + Intergenic
1080724101 11:34877814-34877836 TTCCCAGCTCTCCTGCTCACAGG + Intronic
1081575930 11:44318510-44318532 ATCCCAGCTGTGCTGCTTACTGG + Intergenic
1081979087 11:47255009-47255031 ATTCCCAGTTTCCTGCTCACCGG - Intronic
1083144384 11:60748073-60748095 ATCCCAGCTCTGATGCTAACTGG + Intergenic
1083311516 11:61786237-61786259 AGGCCAGCTCTGCTGTTCACTGG + Exonic
1083805573 11:65071883-65071905 AGTCCTGCTCTGCTGCTCATAGG + Intronic
1084528105 11:69710047-69710069 ATCCCAACTCTGCTGTTTATTGG - Intergenic
1084804220 11:71567533-71567555 ATTCCCACTCTGCTCTTCCCCGG - Intronic
1084806212 11:71581037-71581059 ATTCCCACTCTGCTCTTCCCCGG + Intronic
1084899848 11:72301486-72301508 GTTCCAGCTCTGCTCCTGACTGG - Intronic
1086513627 11:87587813-87587835 ATACCACTTCTGCTGGTCACTGG + Intergenic
1087285892 11:96264928-96264950 CTTCAAACTCTTCTCCTCACAGG - Intronic
1088454590 11:110020462-110020484 ATTCCAACTCTACTTCCCACTGG + Intergenic
1089238928 11:117057714-117057736 ATTCCAACTCTGCTACCAAATGG + Intronic
1089278918 11:117358903-117358925 ATCCCATCTCTGCCCCTCACTGG + Intronic
1089872881 11:121692517-121692539 ATTCCAACTGTGGTGCTGAGGGG + Intergenic
1090657177 11:128855001-128855023 ATTCCAGCTCTGCAGCTTACTGG + Intronic
1090712036 11:129395809-129395831 CTTCCAGTTCTGCCGCTCACTGG + Intronic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1090957743 11:131528619-131528641 TTTCCAGTTCTGCTGCTAACTGG + Intronic
1090976425 11:131684025-131684047 ATTCTAACTCTACTACTTACTGG + Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1096534054 12:52259522-52259544 ATTCCAACTCTGCCCCTCTATGG - Intronic
1098237323 12:68429936-68429958 ATTCCAACACTGCTGGACATAGG - Intergenic
1098766709 12:74499423-74499445 AGTCTAACTCAGCTTCTCACAGG - Intergenic
1100615139 12:96225662-96225684 ATCCGGGCTCTGCTGCTCACTGG - Intronic
1101159114 12:101955600-101955622 ATTCCAGATCTGCTGCTCTGGGG + Intronic
1101372148 12:104139328-104139350 ATTCCAACTCCCCTTCTTACAGG + Intergenic
1102216208 12:111163092-111163114 ATCTCAGCTCTGCTGCTGACTGG + Intronic
1102421579 12:112807494-112807516 GTTCCAGCTCTGCTGCTCTGTGG + Intronic
1102804083 12:115764018-115764040 ATTCCAACTTTTCTCCTTACTGG - Intergenic
1104047603 12:125174122-125174144 ATCCCAGCTCTGCCACTCACTGG - Intergenic
1104218946 12:126763331-126763353 ATTTCTGCTCTGCTGCTCATGGG - Intergenic
1104560199 12:129836415-129836437 ATACCAATTCTGCTGATCATAGG - Intronic
1105758343 13:23490528-23490550 CTTCCATCTCTGCACCTCACAGG + Intergenic
1107039226 13:35931944-35931966 ATTCCAACTCTGTTACCCACTGG + Intronic
1107852839 13:44588279-44588301 ATTCCAACTGGCCTGCACACTGG + Intergenic
1111407586 13:87829398-87829420 ATTCCAGCTCTGTAGCTGACAGG - Intergenic
1111611963 13:90616608-90616630 TTTGCAACTCTGCTGCTAAGGGG + Intergenic
1111833486 13:93358520-93358542 ATTCCCACTCTGCTACTTAAGGG - Intronic
1112195548 13:97222588-97222610 ATTCCATGTGTGCTGCTTACGGG + Intronic
1114461570 14:22889393-22889415 ATCCCAACTCTACTGCTTACCGG - Intergenic
1116184780 14:41584415-41584437 ATTCCAACTCCGCTGCCAATTGG - Intergenic
1117235125 14:53765800-53765822 ATTCCAACTCCACTGCTAATTGG - Intergenic
1117522005 14:56560276-56560298 ATTCCTGCTCTGCTGCTCGTTGG + Intronic
1117591278 14:57270535-57270557 ACTCCAACTCTGATGCCCTCAGG - Intronic
1118335606 14:64851258-64851280 ATTCCAGCTCTGCCACTTACTGG + Intronic
1119277829 14:73375406-73375428 ATTCCAGCTCTGCTACTTAGAGG - Intronic
1119821219 14:77617404-77617426 ATTCCAACTCTGCCAATAACTGG + Intergenic
1119980365 14:79073852-79073874 ATTGCAGCTCTGCTACTTACTGG + Intronic
1121626410 14:95388663-95388685 ATCCCAACTCTGCTCCTAAGTGG - Intergenic
1121684667 14:95826857-95826879 CTTCCATCTCTGCTTCACACTGG + Intergenic
1121941748 14:98077348-98077370 ATTCCTTCTCTGCTGCCCACAGG + Intergenic
1122526891 14:102392864-102392886 ATTCAAACTCTGATGCTGAATGG + Intronic
1122636201 14:103130833-103130855 AGCCCATCTCTGCTGCTCCCAGG - Intronic
1122798732 14:104219429-104219451 ATTCCAGCTTTGCTGCTTACGGG - Intergenic
1125100830 15:35910874-35910896 ATCCCCACTCTGCAGCTCAGAGG + Intergenic
1125737955 15:41941746-41941768 ATGCCATCTCTGCTGCTCCGTGG - Intronic
1125745947 15:41997204-41997226 ACTCCAGCTCTGCTGGGCACAGG + Exonic
1125988763 15:44084084-44084106 GTTCCAACTCTGCCACTGACTGG + Intronic
1126141912 15:45445885-45445907 ATCCCAGCTCTGCTGATTACAGG - Intronic
1127568798 15:60220274-60220296 ATTCCAATTCTGCCACTTACTGG - Intergenic
1127644030 15:60942292-60942314 ATCCCAGCTCTGCTGTTTACAGG - Intronic
1128463294 15:67887763-67887785 ATTCCAACCCTGCTACTCCCAGG - Intergenic
1128563302 15:68682745-68682767 ATCTCAGCTCTGCTGCACACTGG - Intronic
1128566833 15:68706295-68706317 CTTCCAACACTGCTCCTCCCAGG + Intronic
1128703187 15:69819295-69819317 ATTCCATGTTTCCTGCTCACAGG - Intergenic
1129373314 15:75111313-75111335 ACTCCAGCTCTGCCACTCACTGG + Intronic
1130809603 15:87363041-87363063 ATTCCAGCTCTGTCACTCACAGG - Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132067539 15:98744520-98744542 ATTCCACCTCTGCTCCTCCCTGG - Intronic
1132598416 16:763441-763463 ATTTCAGCTCTGCCGCTCCCTGG - Intronic
1133101537 16:3483012-3483034 ATTAAGACTCTGCCGCTCACTGG - Intronic
1133105133 16:3502641-3502663 ATTCACACTCTGGTGCTCAGTGG - Intronic
1133297472 16:4761984-4762006 ACTCCTACTCTGCTGGGCACAGG - Intronic
1133477703 16:6139346-6139368 GTCCCAACTCTGCTGCTTTCTGG + Intronic
1133870659 16:9682620-9682642 ATCCCAGCTCTGCCCCTCACTGG + Intergenic
1133912865 16:10081769-10081791 TCTCCAAATCTGATGCTCACTGG + Intronic
1134121912 16:11590072-11590094 ATTCAAACTCTCATGCTCAAGGG - Intronic
1134392959 16:13836717-13836739 ATTCCAGCTCTACCACTCACTGG - Intergenic
1134617837 16:15665355-15665377 ATTCCAGCTCTGCTACTTATTGG - Intronic
1134757307 16:16679355-16679377 ATTGCAACTCTGCTTCTCTTAGG + Intergenic
1134988762 16:18679811-18679833 ATTGCAACTCTGCTTCTCTTAGG - Intergenic
1135156456 16:20057195-20057217 ATCTCAGCTCTGCTGCTCACTGG + Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135397201 16:22140214-22140236 ATGCCAACTCTGCTACTGAGTGG - Exonic
1135797880 16:25463043-25463065 CTCCCAACTCTGCTACTTACTGG - Intergenic
1137259316 16:46811042-46811064 ATTTAAACTGTGCTACTCACGGG + Intronic
1137820343 16:51438520-51438542 ATTTCAGCTCTGCTACTCAGAGG - Intergenic
1138034001 16:53584063-53584085 CTTCCAGCTCTGATGCTTACTGG - Intergenic
1138336578 16:56258244-56258266 CTCCCAGCTCTGCTGCTTACTGG + Intronic
1140260994 16:73379447-73379469 GTTCCACCTCTGCTACTTACAGG + Intergenic
1141802394 16:86319727-86319749 AATTGAACTCTGCTCCTCACTGG - Intergenic
1141894839 16:86952853-86952875 ATTTGATCTCTGCTGGTCACTGG + Intergenic
1142713743 17:1736981-1737003 ATCCCAGCTCTGCTGCTTGCTGG + Intronic
1144250373 17:13410319-13410341 ATTCCATCTCGCCTGCTCTCTGG - Intergenic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1144450102 17:15370145-15370167 TTTGCAACTCTGTGGCTCACTGG - Intergenic
1144772516 17:17767798-17767820 ATTCCAGCCTTGCTACTCACAGG + Intronic
1147385779 17:40081090-40081112 GTTCTGACTCTGCTGCCCACCGG + Intronic
1148960637 17:51389755-51389777 ATTCCATCTCTGCTATTAACTGG - Intergenic
1150624238 17:66831329-66831351 ATTCCATCTCTGCTCTACACTGG + Intergenic
1152092004 17:78252325-78252347 AAACCCACTCAGCTGCTCACCGG - Intergenic
1152476351 17:80520999-80521021 GTTCCAGCTCTGCTGTTCTCTGG - Intergenic
1153332097 18:3883848-3883870 CTTCTAACTCTGCAACTCACTGG + Intronic
1153383394 18:4464159-4464181 ATTTCGACTCTGCCGCTCACCGG - Intergenic
1155996806 18:32339135-32339157 CCTCCAACTCTGCTGCCAACTGG + Intronic
1156050085 18:32922137-32922159 ATTCAAATTCTGCTGCTCCATGG - Intergenic
1156613033 18:38750166-38750188 ATTCCAGCCATGCTGCTCATGGG + Intergenic
1157547471 18:48556538-48556560 TTACCCACTCAGCTGCTCACTGG + Intronic
1157744903 18:50126814-50126836 ATCCCAGCCCTGCTGCTCTCTGG + Intronic
1160374699 18:78402528-78402550 TTTCCAACTGTGCACCTCACAGG + Intergenic
1160422662 18:78757979-78758001 ATTCCGATTCTGCTGATCAGAGG - Intergenic
1161655580 19:5512609-5512631 ATTCTAGCTCTGCCGCCCACTGG - Intergenic
1166050560 19:40256532-40256554 CTTCCCACTCAGCTGGTCACAGG - Intronic
1168161945 19:54516212-54516234 ATCCCAAGTCACCTGCTCACAGG - Intergenic
926027421 2:9556590-9556612 ATTCCAGCTCTTGTACTCACAGG - Intergenic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927482690 2:23466990-23467012 ATCCCAACTCTCCTGCTGACTGG + Intronic
928854655 2:35789628-35789650 CTTGCAACTCTGCTGCTAAGGGG - Intergenic
929430329 2:41880868-41880890 AGTCCCACTCTGTTGCTCCCAGG + Intergenic
930376169 2:50569712-50569734 ATACTAATTCTGCAGCTCACAGG + Intronic
931784817 2:65609171-65609193 ATTTCAACTCCCCAGCTCACGGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
931996833 2:67846591-67846613 ATTCCAAGTCTGGTTCTCAGAGG - Intergenic
933948838 2:87311010-87311032 GTCCTGACTCTGCTGCTCACTGG - Intergenic
936331360 2:111550586-111550608 GTCCTGACTCTGCTGCTCACTGG + Intergenic
936681268 2:114775027-114775049 ATTCCATCTCTGCCACTTACTGG - Intronic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
939049477 2:137290649-137290671 ATTCTAAGTCTGGTGCTGACAGG - Intronic
939380949 2:141435634-141435656 ACTCCCACTCTGGTGCACACTGG + Intronic
940190014 2:151030899-151030921 ACTCCAACCTTCCTGCTCACTGG - Intronic
941774179 2:169374115-169374137 ATTCCAGGTTTGCTGCTAACAGG - Intergenic
943457931 2:188130526-188130548 CTGCAATCTCTGCTGCTCACTGG + Intergenic
943699092 2:190970926-190970948 ATTATTACTCTGCTGCCCACTGG + Intronic
945315758 2:208369302-208369324 ATTCCAACTTGGTTGTTCACAGG + Intronic
946123010 2:217532903-217532925 ATCACAACTCTGCTGTTTACAGG + Intronic
946680716 2:222212460-222212482 ATTGCACCTCTGCTGATCAATGG - Intronic
947976741 2:234373209-234373231 AAACCAACTCTTCTGCCCACGGG - Intergenic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1168913055 20:1465614-1465636 ATTCCAACCCCGCTACTTACTGG + Intronic
1169064444 20:2686643-2686665 ATCCCATCTCTGCCACTCACTGG - Intergenic
1170457591 20:16547878-16547900 TCTCCAGCTCTGCTGCTCACAGG + Intronic
1171411702 20:24952309-24952331 ATTCCAGCTCTGCTTCTCACTGG - Intronic
1171517284 20:25747575-25747597 ATTCCAACTGTGCTTTTCAATGG - Intergenic
1172064661 20:32210470-32210492 ATTCCAGCTCTCCTACTCACAGG - Intronic
1172336851 20:34123539-34123561 ATTCCATCTCTGTTACTCACTGG - Intergenic
1173000228 20:39100182-39100204 ATAGCAATTCTGCTTCTCACAGG + Intergenic
1173840831 20:46155934-46155956 ATGCCAACTCTGCTATTTACCGG + Intergenic
1174643499 20:52065756-52065778 AGACCAGCTCTGCTGCTCACTGG - Intronic
1175154948 20:56964465-56964487 ATTCCAGCTCTGCCCCTTACCGG + Intergenic
1175765054 20:61586686-61586708 ATACCAGCTCTGCCACTCACTGG - Intronic
1178788361 21:35675299-35675321 CTTCCATCTCTGCTGGCCACCGG + Intronic
1179095998 21:38314759-38314781 CTTCCAACTGGGCTGCTCCCAGG + Intergenic
1181610280 22:24007305-24007327 TTTCCAACTCTGATCCTCCCTGG + Intergenic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1182760732 22:32720596-32720618 ATCCCAACACTGCTATTCACTGG - Intronic
1182956001 22:34427117-34427139 ATTCTAGCTATGCTGCTTACAGG - Intergenic
1183754094 22:39742921-39742943 TTCCCAACCCTGCTGCACACTGG - Intergenic
1184264016 22:43337182-43337204 AGCCCAGCTCTGCTGCTCACTGG - Intronic
1184887648 22:47356199-47356221 ATTTCCACTCTACTGCTCGCGGG - Intergenic
949184441 3:1173217-1173239 AGTCCAATTCTGCTGCTAACTGG + Intronic
951840905 3:27032855-27032877 TTTTCAACTCTGCTGCTTCCTGG - Intergenic
951939071 3:28057809-28057831 ATTTCAACTCTGCTTCTGTCTGG + Intergenic
952378883 3:32789128-32789150 ATCCCAGCTCTGCTACTCCCTGG + Intergenic
953259034 3:41320113-41320135 ATTCTAGCTCTGCTGTTTACTGG + Intronic
953845134 3:46420744-46420766 CTTGCAACTCTGCTGCTAATGGG + Intergenic
955398432 3:58573864-58573886 ATCTCAACTCTGCTGTTCAGTGG - Intronic
957708678 3:83824020-83824042 ATTCTAACTCTGTTGCAAACTGG - Intergenic
960524016 3:118688800-118688822 ATTCCCACTGTGCTGAACACAGG - Intergenic
962843925 3:139259010-139259032 CTTCCAGCTCTGCTGTTCCCTGG + Intronic
964432743 3:156623352-156623374 CTTGCAACTCTGCTGCTAAGGGG - Intergenic
965638572 3:170809482-170809504 AGTCCAGCTCTGCCGATCACTGG - Intronic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
968886408 4:3336192-3336214 ACTCCAACTTGGCAGCTCACAGG - Intronic
969847980 4:9934609-9934631 AATCCAGCTCTGCTACTAACTGG - Intronic
970136871 4:12935013-12935035 TTTCCAACTCTGCTACTCCTTGG - Intergenic
970908664 4:21248312-21248334 GTTCTAACTCTGCTTCTCTCAGG - Intronic
972407198 4:38758082-38758104 CCTCCAACTCTGTGGCTCACCGG + Intergenic
972442760 4:39112453-39112475 GTCCCAATTCTGCTGCTTACTGG + Intronic
973777809 4:54259197-54259219 ATCCCACCTCAGCTGCTCAAGGG - Intronic
973804154 4:54509328-54509350 ATTCCGGCTCTGCCACTCACCGG + Intergenic
975650023 4:76583639-76583661 ATTCCAGATCTGCTGCTTGCTGG + Intronic
976200096 4:82569438-82569460 TTTGCAACTCTGTTTCTCACTGG - Intergenic
976751885 4:88457428-88457450 GCGCCAACTCTGCTGCTCGCCGG + Exonic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
979547670 4:121955720-121955742 ATCCCACCTCTGCTGCTCACAGG + Intergenic
980622006 4:135320082-135320104 ATTCCAACTGTGGTGGTCACAGG - Intergenic
980722396 4:136716122-136716144 ACTCCAACTGGCCTGCTCACTGG + Intergenic
981717970 4:147770695-147770717 ATTCCACCTCTGCTACATACTGG + Intronic
985951594 5:3225613-3225635 ATTGCAACTGGGCTGCTCTCAGG + Intergenic
986994713 5:13593743-13593765 TTTCCAACTCTGCGACTCCCAGG + Intergenic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
987443908 5:17992507-17992529 ATTCCATTTCTACTGCACACGGG - Intergenic
988491664 5:31710448-31710470 ATTCCGGCTCTGCAGCTTACTGG + Intronic
989115473 5:37948522-37948544 ATCCCACCTCTGTTGCTAACTGG - Intergenic
990798719 5:59574525-59574547 AATTCAACTCTGATGCTGACTGG - Intronic
991900180 5:71452742-71452764 AAAACAACTCTGCTACTCACCGG - Intergenic
992272771 5:75082531-75082553 TTTCAAAATCTGCTGCTCACTGG + Intronic
992468607 5:77031317-77031339 ATCCCATCTCTGCTATTCACTGG + Intronic
995137197 5:108692406-108692428 TTACCATCTCTGCTTCTCACTGG + Intergenic
995367591 5:111381068-111381090 ATTCCAACACAGCAGCTGACAGG - Intronic
995435583 5:112131437-112131459 GTTCCAGCTCTGCTACTAACTGG - Intergenic
995614093 5:113941787-113941809 GTTCCAACTCTGTTGCTTTCTGG - Intergenic
997374302 5:133386016-133386038 ATTGCAGCTCTCCTCCTCACCGG + Intronic
997836467 5:137197380-137197402 ATTCCAGCTCTGCAGTGCACTGG + Intronic
998256398 5:140591897-140591919 AGTCTCACTCTACTGCTCACTGG - Intronic
998792685 5:145782322-145782344 ATTCCAGCTCTGCCACTTACTGG + Intronic
999539632 5:152557371-152557393 ACTGCATCTCTGCTACTCACCGG + Intergenic
999772407 5:154785579-154785601 CTACCTACTCTGCTCCTCACAGG - Intronic
999975973 5:156912457-156912479 TTTCAAACTCAGCTGCACACTGG - Intergenic
1000139447 5:158387770-158387792 ATACAAACTCTGCTGTTAACTGG - Intergenic
1001363304 5:171110161-171110183 ATTCCAACTCTGTTACTTCCTGG + Intronic
1001690340 5:173628317-173628339 ATTCCAACTCTCCAGCTTTCCGG - Intergenic
1001791356 5:174460115-174460137 ACCCCAGCTCTGCTGCTCATGGG - Intergenic
1002541858 5:179911437-179911459 ATGCCAACTTTGCTCCTCATTGG - Intergenic
1003506877 6:6746877-6746899 ATTCCTACTCTGTGGCTCTCAGG - Intergenic
1003609143 6:7592654-7592676 ATTCCATCTCTGCCACTTACTGG - Intronic
1005571023 6:27145858-27145880 ATTCCATCTCTGCAGCCCACGGG - Intergenic
1005817870 6:29571146-29571168 ATTCCAAATCTGGTGCTCCTGGG - Intronic
1006735198 6:36268406-36268428 ATCCCAACTCTGCTATTTACAGG - Intronic
1007398186 6:41589148-41589170 ATCCCAGCTCTGCCACTCACAGG - Intronic
1007940811 6:45779566-45779588 ATTCCAGCTCTGCCGCTCCTGGG - Intergenic
1008417257 6:51256394-51256416 ATCTCAGCTCTGCTGCTCACTGG - Intergenic
1009967879 6:70596195-70596217 CTGTCAACTCTGCTTCTCACAGG - Intergenic
1010618077 6:78038589-78038611 ATTAGGACTCTGCTGCTTACTGG - Intergenic
1011748044 6:90426500-90426522 ATTTCATGTCAGCTGCTCACAGG + Intergenic
1011786808 6:90855748-90855770 ATTCTAACTCTGCTGGTCCCAGG + Intergenic
1012373214 6:98531266-98531288 CTTGCAACTCTGCTGCTAAGGGG - Intergenic
1018089421 6:160332843-160332865 ATTCCAACTCTGCTTCTTAGTGG + Intergenic
1023460215 7:40387940-40387962 ATTCCAACTCATCCGCTTACAGG - Intronic
1026489309 7:70849017-70849039 ATTCAAACTCTGCAACTAACTGG - Intergenic
1029231764 7:99075600-99075622 ATCCCAATTCTGATGCTAACTGG - Intronic
1032713191 7:134480822-134480844 ATTCCAACTCTGCTTTTTACTGG - Intergenic
1035057972 7:156049606-156049628 CTCCCAGCTCTGCTGCTCTCTGG + Intergenic
1036393538 8:8346705-8346727 ATTCACTCTCTGCTGCACACTGG - Intronic
1036847421 8:12179299-12179321 ACTCCAACTGTTCTGCTCACTGG - Intergenic
1037291250 8:17351376-17351398 ATTCCAGCTATGGTGCACACAGG - Intronic
1037375574 8:18224125-18224147 TTTCCAGCTCTGCTGCTATCTGG + Intergenic
1037721943 8:21451727-21451749 ATTCCAACTCTTAGGCTCAAAGG - Intergenic
1038442322 8:27579977-27579999 TTTTCATCTCTGCTGCACACTGG + Intergenic
1038952487 8:32431135-32431157 ATCCCAACTCTGCCACTAACTGG - Intronic
1039743940 8:40406912-40406934 TTTCCACCTCTGCTGTTCGCTGG + Intergenic
1040549516 8:48427662-48427684 ATTCCAGCTCTGCTGAGCACAGG - Intergenic
1041784486 8:61616369-61616391 GCCCCAAATCTGCTGCTCACAGG - Intronic
1042042162 8:64604140-64604162 ATTGTAAAGCTGCTGCTCACGGG - Intronic
1042259181 8:66839144-66839166 ATTCCATCTCTGCTCCTTTCTGG - Intronic
1043730828 8:83678328-83678350 ATTCTATTTCTGCTGCACACAGG - Intergenic
1043792493 8:84490258-84490280 ATACCATCTCTTCTGCTTACTGG + Intronic
1045255471 8:100516980-100517002 ATCCCAGCTCTGCCGCTTACTGG + Intronic
1045869891 8:106913560-106913582 ATCCCCACTCTGCTGATAACAGG - Intergenic
1046135532 8:110021217-110021239 ACTCCAACTCTGCCACTGACTGG + Intergenic
1046527282 8:115396701-115396723 ATCCCACTTCTACTGCTCACTGG - Intergenic
1047178390 8:122564083-122564105 ATTTCAGCTCTGCTGCTTACCGG + Intergenic
1048468554 8:134687136-134687158 CTTCCAGCTCTGATGCTCAGTGG + Intronic
1048574513 8:135680180-135680202 CTTCCAACACTGCTGGTCTCTGG + Intergenic
1048998050 8:139806311-139806333 ATACCACCACTGCTGCGCACAGG - Intronic
1049270605 8:141693681-141693703 TCTCCACCTCTGCTGCCCACCGG - Intergenic
1050071038 9:1814484-1814506 ATTCCATATCTGCTGCTGCCAGG - Intergenic
1050177209 9:2880711-2880733 ATGCCAACACTGCTGGTCATGGG - Intergenic
1051357068 9:16249377-16249399 ATCCCAACTCTGCCGCATACTGG + Intronic
1051378281 9:16427738-16427760 ATTCCATCTCTGCTGATGAATGG + Intronic
1058911264 9:109522001-109522023 ATTCCAGCTCTGCCACTGACAGG - Intergenic
1059781672 9:117535274-117535296 ATTCCACATCTTCTGCTCAGAGG + Intergenic
1060081499 9:120651419-120651441 ATTCCAACTCTTTTACTTACTGG + Intronic
1060326776 9:122624013-122624035 ATTCCAATGTTGCTGCTCAGTGG - Intergenic
1060698160 9:125727949-125727971 ATCCCAGCTCTGCTACTCTCTGG + Intergenic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062026042 9:134341274-134341296 ATCCCGACTCTGCTGTTAACTGG - Intronic
1062370251 9:136235086-136235108 CATCCAGCTCTGCTGCTTACTGG + Intronic
1062577824 9:137216749-137216771 ATGCCACCCCTGGTGCTCACTGG - Exonic
1187075749 X:15932753-15932775 ATTCCCACTCTGTTACTTACAGG + Intergenic
1188258797 X:27997676-27997698 ATTCCAACTTCACTGCCCACAGG - Intergenic
1192219428 X:69187235-69187257 AGCACAACTCTGCTGCTCATTGG - Intergenic
1193144215 X:78060765-78060787 ATAACAGCTCTGCTCCTCACTGG + Intergenic
1195876675 X:109549802-109549824 ATTCCAATTCTCTTGCTCAACGG + Intergenic
1196132591 X:112173402-112173424 ATCCCAGCTCTGCCGCTTACTGG + Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1197263697 X:124343863-124343885 ATTTCAACTCTCCTACTTACTGG + Intronic
1198581282 X:138067494-138067516 TTTCCAACTCTGCTCTTTACAGG - Intergenic
1201888993 Y:18920739-18920761 CTTCCAACTCTGCTGGTTTCTGG - Intergenic