ID: 1061358071

View in Genome Browser
Species Human (GRCh38)
Location 9:130121456-130121478
Sequence TGGGACCCCCAAAACCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061358065_1061358071 17 Left 1061358065 9:130121416-130121438 CCTGGGGCGCAGGTTGGACAAGC 0: 1
1: 7
2: 39
3: 90
4: 187
Right 1061358071 9:130121456-130121478 TGGGACCCCCAAAACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061358071 Original CRISPR TGGGACCCCCAAAACCAACA AGG Intronic
No off target data available for this crispr