ID: 1061359575

View in Genome Browser
Species Human (GRCh38)
Location 9:130132421-130132443
Sequence CAGGGTGGACACAGGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061359575_1061359586 14 Left 1061359575 9:130132421-130132443 CCTGCCGTCCTGTGTCCACCCTG 0: 1
1: 0
2: 3
3: 26
4: 275
Right 1061359586 9:130132458-130132480 ACTCTCCTTCCCAGACTGGCTGG No data
1061359575_1061359584 10 Left 1061359575 9:130132421-130132443 CCTGCCGTCCTGTGTCCACCCTG 0: 1
1: 0
2: 3
3: 26
4: 275
Right 1061359584 9:130132454-130132476 TGCCACTCTCCTTCCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061359575 Original CRISPR CAGGGTGGACACAGGACGGC AGG (reversed) Intronic
900373135 1:2341134-2341156 CAGGTGGGACACAGCAGGGCTGG - Intronic
900427423 1:2586955-2586977 CCGGGTGGACGCAGGGCGGTGGG + Intronic
900480698 1:2897663-2897685 CAGTGTGGACACTGGGCTGCTGG - Intergenic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901445438 1:9305319-9305341 CAGGGTGGACCGTGGATGGCAGG - Intronic
901920074 1:12529709-12529731 AAGGGTGGACCCAGGAAGGATGG - Intergenic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902663233 1:17920062-17920084 ATGGGTGGACACAGGACAGAGGG - Intergenic
903264717 1:22150892-22150914 CAGGGGGATCCCAGGACGGCAGG - Intergenic
903663299 1:24991808-24991830 CAGGGAGGGCACAGGAGGGGAGG - Intergenic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
905400737 1:37701235-37701257 CAGGGTGGACACTAGAGGGAGGG + Intronic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
905452886 1:38068412-38068434 CAGCGTGAAAACAGGAAGGCTGG - Intergenic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907869107 1:58426866-58426888 CAGGGAGGAATCAGGACTGCTGG + Intronic
908646513 1:66284138-66284160 CTGGAAGGACACAGGAAGGCAGG + Intronic
912449856 1:109762000-109762022 CAGGGAGGCCACAGCATGGCTGG + Intronic
913693269 1:121299947-121299969 CAAGGTGAACCCAGGAAGGCAGG + Intronic
914144286 1:144980133-144980155 CAAGGTGAACCCAGGAAGGCAGG - Intronic
915069146 1:153251641-153251663 TACAGTGGACACAGGACAGCTGG + Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
917836896 1:178948202-178948224 GAGGGTGGACACAGGACTTGGGG - Intergenic
919797696 1:201331292-201331314 CAGAGTGGAGACAAGACAGCTGG - Exonic
920480592 1:206318316-206318338 CAAGGTGAACCCAGGAAGGCAGG + Intronic
921068979 1:211643333-211643355 CGGGGAGGCCACAGGACAGCCGG - Intergenic
924932858 1:248746522-248746544 CTGAGAGGACACAGGAAGGCAGG + Intronic
1062989233 10:1800069-1800091 CAGGGTGGTCACTGGAAAGCGGG + Intergenic
1065972984 10:30819547-30819569 CAGGATGGACTCTGGGCGGCTGG - Intergenic
1066128647 10:32368004-32368026 AAGTGTGGACACTGGACAGCAGG - Intronic
1067458608 10:46441074-46441096 CAGGATGAACACAGGAGGGCTGG + Intergenic
1067628588 10:47943562-47943584 CAGGATGAACACAGGAGGGCTGG - Intergenic
1068077227 10:52271409-52271431 CATTGTGGACACAAGACAGCAGG + Exonic
1073076258 10:100827259-100827281 CAGGGAGGGCACGGGAGGGCAGG - Intronic
1076781020 10:132724658-132724680 CAGGGAGGCCCCAGGACGACAGG + Intronic
1076886897 10:133267161-133267183 CAGCGAGGCCACAGGAAGGCAGG - Intronic
1077240665 11:1508807-1508829 CAGGGTGGACTCCAGAAGGCTGG + Intergenic
1077441759 11:2572140-2572162 CAGGTTGGGGACAGGACGGAGGG + Intronic
1077724547 11:4661224-4661246 CAGGGTGGAAACAGAACGAGTGG + Intergenic
1080641234 11:34159717-34159739 CGGGGTGGACCCAGGGCAGCAGG - Intronic
1083222788 11:61264523-61264545 CAGGGTCGGCACAGGCCCGCTGG + Exonic
1083853523 11:65380884-65380906 CAGAGGGGACTCAGGACAGCAGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084483928 11:69437281-69437303 CAGGGCTGACACAGCACGCCTGG - Intergenic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1086697267 11:89860852-89860874 CAGGGTGGCTGCCGGACGGCGGG - Intergenic
1086708892 11:89983635-89983657 CAGGGTGGCTGCCGGACGGCGGG + Intergenic
1089130208 11:116206444-116206466 CCAGGTGGACACAGGACTGGAGG - Intergenic
1090024968 11:123159674-123159696 CAGGGGGCACACAGGAAGGGTGG + Intronic
1092565611 12:9662215-9662237 AGAGGTGGACACAGGATGGCAGG + Intergenic
1096228550 12:49884623-49884645 CAGGCTGGGCACAGGACACCTGG + Intronic
1096867017 12:54570652-54570674 CAGTGTGGACACTGGAGGCCTGG + Intronic
1097326531 12:58283651-58283673 AAGAGTGGACACAGGGAGGCTGG - Intergenic
1102739178 12:115191469-115191491 GAGGGTGGAGATAGGAGGGCTGG + Intergenic
1102880377 12:116480651-116480673 CAGGGTGGCAAGAGGAAGGCAGG - Intergenic
1103846920 12:123908219-123908241 CAGGGAGGAGACAGGAAGACAGG - Intronic
1103960161 12:124604316-124604338 CAGAGTGGAGACAGCAGGGCAGG - Intergenic
1104450317 12:128863698-128863720 CAGGTTTTACACAGGAAGGCAGG + Intronic
1104678129 12:130729525-130729547 CAGAGTGGATGCAGGACAGCAGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106100760 13:26694021-26694043 CAGGAGGGACACAGGGCTGCTGG - Intergenic
1106192606 13:27466759-27466781 GAGGGTGGAGACAGGCCGGGTGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1110423769 13:75341953-75341975 CAGTGTGGCCACAGTATGGCAGG + Intronic
1113651454 13:112036682-112036704 GAGGGTGGAGAGGGGACGGCAGG - Intergenic
1113653806 13:112056103-112056125 CCGGGTGGACACGGGACGGGAGG + Intergenic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114538741 14:23439343-23439365 CAGGCTGCAGACAGGAGGGCCGG + Intergenic
1114917334 14:27285350-27285372 CAGGCTGGACCCAGTACAGCTGG - Intergenic
1118436864 14:65779526-65779548 CAGGGTTGCCACATGACTGCTGG + Intergenic
1120822822 14:88928743-88928765 CATGGAGGACTCAGGAGGGCAGG + Intergenic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121523230 14:94600372-94600394 CAGGCTGGGCACAGGTCAGCTGG + Intronic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1122542208 14:102504914-102504936 CAGGCAGGACACAGGCTGGCGGG - Exonic
1123116166 14:105895037-105895059 CAAGCAGGACTCAGGACGGCCGG + Intergenic
1123200984 14:106663906-106663928 CAGGGGGCGCTCAGGACGGCAGG - Intergenic
1123203621 14:106691786-106691808 CGGGGTGCACTCAGGACAGCAGG - Intergenic
1123203696 14:106692079-106692101 CAGGGGGCACTCAGGACAGCAGG - Intergenic
1124278282 15:28344001-28344023 CAGGGGGGACCCAGGATGGGTGG - Intergenic
1124304420 15:28567607-28567629 CAGGGGGGACCCAGGATGGGTGG + Intergenic
1127762127 15:62149833-62149855 CAGGGAGGAGACAGGAAGGCAGG + Intergenic
1128128274 15:65208885-65208907 CAGGGTGGAAAGAGCAAGGCAGG + Intronic
1128304068 15:66586643-66586665 CAGCGTGGACTCAGGCAGGCTGG + Intronic
1128346917 15:66859860-66859882 CAGGGTGGTCACTGGGCAGCAGG - Intergenic
1128413496 15:67422450-67422472 CAAGGAGTACACAGGACTGCAGG - Intronic
1128632141 15:69278543-69278565 CTGTGTGGACACAGGATTGCAGG + Intergenic
1129088062 15:73118263-73118285 CAGGGTGGAGACTGGACTGGAGG - Intronic
1129519763 15:76178252-76178274 CAGGGTGGAGACAGGAAGACTGG + Intronic
1129834421 15:78693002-78693024 CAGGGTGGGAACAGGATGCCAGG - Intronic
1130104761 15:80921025-80921047 GAAGGTGGACACAGCACTGCAGG - Exonic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1132547482 16:540093-540115 GAGGGAAGAGACAGGACGGCCGG - Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1132576310 16:665973-665995 CAGGGCGGCCACAGCACGGGGGG - Exonic
1132648770 16:1011036-1011058 CAGGGTGGTCCCAGGAGCGCCGG + Intergenic
1133610700 16:7430753-7430775 CAGGGTCCACACAGGAAGCCTGG + Intronic
1135304271 16:21355149-21355171 CAGGATGGAAAACGGACGGCCGG - Intergenic
1136071547 16:27790715-27790737 CAGGCTGGACACAGGCTGGCAGG - Exonic
1136301013 16:29334279-29334301 CAGGATGGAAAATGGACGGCCGG - Intergenic
1136449130 16:30342820-30342842 CAGAGTGGTCACAGGAAGTCTGG - Intergenic
1136713450 16:32258664-32258686 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136754461 16:32670767-32670789 CATTGTGGCCACAGGAGGGCAGG - Intergenic
1136813652 16:33199598-33199620 CATTGTGGCCACAGGAGGGCAGG + Intronic
1136820128 16:33309678-33309700 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136826691 16:33366217-33366239 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136831757 16:33464988-33465010 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1138161439 16:54758528-54758550 CTGGGTGGACACAGGCTGGCTGG + Intergenic
1138597622 16:58037506-58037528 CATGGTGGACATATGGCGGCTGG - Exonic
1139329486 16:66176350-66176372 CAGGGGGCACAGAGGACAGCAGG - Intergenic
1139474593 16:67196686-67196708 TTGGATGTACACAGGACGGCAGG - Intronic
1140221846 16:73049182-73049204 CAGGGAGGACAGAGGACTTCCGG - Intronic
1140949765 16:79805770-79805792 CAGAGTGGACACAGCCCAGCAGG - Intergenic
1141070931 16:80954214-80954236 AAGAGTGGACAGAGGAAGGCTGG + Intergenic
1142277981 16:89132917-89132939 CAGGGCCCACAGAGGACGGCGGG + Intronic
1142283617 16:89161764-89161786 CAGGGTGGGCACAGGACCCCAGG + Intergenic
1202992228 16_KI270728v1_random:22572-22594 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1203056608 16_KI270728v1_random:931098-931120 CATTGTGGCCACAGGAGGGCAGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142625223 17:1187452-1187474 CAGCTTGGACACAGGGCTGCAGG + Intronic
1142979456 17:3663314-3663336 CGGTGTGGACACACGAGGGCTGG + Exonic
1143955339 17:10663644-10663666 CTGGGGGGACACAGGACAGGAGG + Intergenic
1145241292 17:21242252-21242274 CAGGCTGCACCCAGGAAGGCTGG + Exonic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1148090075 17:45018287-45018309 CAGGGGGGAATCAGGACAGCTGG - Intergenic
1148572299 17:48679846-48679868 GAGGGTGGACACGGGACTGAAGG - Intergenic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1150594835 17:66594787-66594809 CAGGTTGGCCACAGAACTGCAGG + Intronic
1151545532 17:74790682-74790704 CAGGGAGGAGACAGCAAGGCAGG - Intronic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1152728272 17:81958256-81958278 CAGGGAGGAGGCAGGACGGCAGG - Intronic
1152858080 17:82677614-82677636 GAAGGTGGACACGGGAAGGCAGG - Intronic
1153024262 18:658646-658668 CGGGGTGGGCACAGGACGTTAGG + Intronic
1155570170 18:27184728-27184750 GAGGTTGGAAAGAGGACGGCAGG - Intronic
1157544531 18:48538886-48538908 CAGGGTGGCCCCAGGACGCTCGG - Intergenic
1157809001 18:50679850-50679872 CAGGAGGGACACAGGAAGGAGGG - Intronic
1160040567 18:75341403-75341425 CGGGGTGGACACGGGTCTGCCGG + Intergenic
1160497456 18:79383680-79383702 CAGTGTGGACTCAGGAAGACAGG + Intergenic
1160970370 19:1765238-1765260 CAGGGTGGCACCAGGACGGGAGG - Intronic
1161332730 19:3696098-3696120 TAGTGTGGTCACAGGGCGGCCGG - Intronic
1162345178 19:10114546-10114568 GAGGGTGGACACAGAAGGCCAGG - Exonic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1163919594 19:20276237-20276259 CAGGGAAGAGAAAGGACGGCCGG + Intergenic
1163948805 19:20565429-20565451 CAGGGAAGACACAGGACGCCAGG + Intronic
1163983497 19:20923584-20923606 CAGGGAAGAGACAGGACGCCCGG - Intronic
1164023397 19:21329003-21329025 CAGGGAAGAGACAGGACGCCCGG + Intronic
1164026693 19:21359330-21359352 CAGGGAAGAGACAGGACGCCCGG - Intronic
1164030305 19:21397455-21397477 CAGGGAAGAGACAGGACGCCCGG - Intronic
1164096007 19:22010587-22010609 CAGGGAAGAGACAGGACGCCCGG + Intronic
1164100815 19:22052822-22052844 CAGGGAAGAGACAGGACGCCCGG - Intronic
1164115507 19:22215442-22215464 CAGGGAAGAGACAGGACGCCCGG + Intergenic
1164136534 19:22421986-22422008 CAGGGAAGAGACAGGACGCCCGG + Intronic
1164162232 19:22634663-22634685 CAGGGAAGAGACAGGACGCCCGG - Intronic
1164213116 19:23117359-23117381 CAGGGAAGAGACAGGACGCCGGG - Intronic
1164241705 19:23395117-23395139 CAGGGAAGAGACAGGACGCCCGG + Intronic
1164279657 19:23758562-23758584 CAGGGAGGAGAAAGGACGCCCGG + Intronic
1164671941 19:30077392-30077414 CAGGTTGGGCACAGGTGGGCAGG - Intergenic
1165255512 19:34575420-34575442 CAGGGTGCAGACTGGAAGGCTGG + Intergenic
1165322866 19:35096979-35097001 CCTGGTGGACCCAGGACAGCCGG + Intergenic
1167072475 19:47228703-47228725 CAGGGCTCACACAGGACGGATGG + Intronic
1167510228 19:49891840-49891862 CCGGGAGGACACAGCACGCCTGG - Intronic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168353299 19:55688306-55688328 GAGAGAGGACACAGGAAGGCAGG - Intronic
925152888 2:1627806-1627828 CGGGGTGGATACAGGCAGGCTGG + Intergenic
925641680 2:5991541-5991563 CTGGGAGGACACAGGAATGCAGG + Intergenic
926247819 2:11133599-11133621 CAGGGTGGAAAAGGGAGGGCAGG - Intronic
928085778 2:28345397-28345419 CAGGTTTGACTCAGGCCGGCTGG - Intergenic
929430673 2:41883711-41883733 CAGGCAGGACACAGGCCGTCTGG + Intergenic
932702632 2:74002012-74002034 CAGGGTTGACACAGGAGGTGTGG + Intronic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937485960 2:122314948-122314970 CCGAGTGGACACAGTCCGGCGGG + Intergenic
938240891 2:129741654-129741676 CAGGGTGCACTCAGGTGGGCAGG - Intergenic
938289463 2:130141766-130141788 CAGGCAGGACACAGGAGGGATGG - Intronic
938467065 2:131531172-131531194 CAGGCAGGACACAGGAGGGATGG + Intronic
944457250 2:199908261-199908283 ATGGGTGGATACAGGAAGGCAGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948518973 2:238523739-238523761 CAGCATGGGCACAGGACGTCTGG + Intergenic
948711804 2:239829797-239829819 CAGGCTGGACCCAGGCCTGCAGG - Intergenic
949003888 2:241634393-241634415 CAGGATGGCCTCAGGACAGCAGG + Intronic
949035969 2:241815883-241815905 CTGGGAGGACTCAGGGCGGCTGG + Intronic
1172104748 20:32510280-32510302 CAGTGTGGGGACAGGAGGGCTGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1175736059 20:61388127-61388149 CAGGGTGGAGACGGCAGGGCTGG + Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1176115702 20:63431032-63431054 CACGGGGGACACAGGCGGGCTGG + Intronic
1179934015 21:44591153-44591175 CAGGGTGGAACCAGGCCTGCTGG + Intronic
1179940875 21:44638385-44638407 CAGGGTGGAACCAGGCCTGCTGG - Exonic
1180625297 22:17190163-17190185 CAGGGTGGGGTCAGGAGGGCAGG - Intronic
1181108829 22:20589882-20589904 CAGGGAGGACACAGGCCTGCAGG - Intergenic
1181236183 22:21448870-21448892 CGGGGTGGCGTCAGGACGGCAGG - Exonic
1181236483 22:21450494-21450516 CAGGATGGCCGCAGGAGGGCAGG - Exonic
1181260504 22:21593807-21593829 CAGGCTGGTCACAGGACTGGGGG - Intronic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1181788392 22:25243991-25244013 CAGGGCAGCCACAGGACGCCTGG - Intergenic
1182709764 22:32313562-32313584 CAGTGTGGAAACAGGTCTGCTGG + Intergenic
1183393861 22:37560723-37560745 CCGGGTGCCCACAGGAAGGCCGG + Intronic
1183675573 22:39297214-39297236 CAGCGTGGAGACAGGGCGGGAGG + Intergenic
1184114939 22:42416921-42416943 CAGGGTGGATACCAGACGCCGGG + Intronic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1185292066 22:50032178-50032200 CTGGGTGGGCTCAGCACGGCTGG - Intronic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
949961296 3:9314652-9314674 CAGGGTGGAGAGAGGAGGGCAGG - Intronic
950572106 3:13807664-13807686 AAGGGAGGCCACAGGAAGGCAGG + Intergenic
953186454 3:40642420-40642442 TAGGGTGGACACAGGACACAGGG + Intergenic
953385955 3:42505715-42505737 CAGGCTGGAAACAGGAGAGCTGG + Intronic
954200367 3:49020425-49020447 GAGGGTGGACCCAGGACCTCTGG - Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
956490375 3:69765039-69765061 AAGTGTGCACACAGGATGGCTGG + Intronic
961411072 3:126720787-126720809 GAGGGTGGAAACAGGACACCAGG - Intronic
961783651 3:129336501-129336523 AAGGGTGGAGAGAGGACTGCAGG - Intergenic
962102397 3:132356485-132356507 CAGGGTGGAAATGGGAGGGCTGG - Intronic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
966888153 3:184387972-184387994 CAGGCTGGGCACAGGCCAGCCGG - Exonic
968568411 4:1326999-1327021 CAGGCAGGACCCAGGTCGGCAGG - Intronic
968600837 4:1508598-1508620 CAGGGTGGGCAGAGCCCGGCTGG - Intergenic
968983022 4:3860955-3860977 CGGGTTGGACACAGGGAGGCTGG - Intergenic
968983060 4:3861107-3861129 CAGCGTGGACACAGGAAGGCTGG - Intergenic
976320099 4:83704430-83704452 CTGGGTGGTCGCAGGACAGCAGG + Intergenic
980105980 4:128588912-128588934 CAGGGTGGGCACAGCACCTCTGG - Intergenic
984070863 4:175110164-175110186 CATGGTGGACCCAGGCAGGCTGG - Intergenic
984954580 4:185032820-185032842 TAGGATGGACACTGGATGGCTGG - Intergenic
985634950 5:1031280-1031302 GTGGGTGGACACAGGACCCCAGG - Intronic
985643954 5:1076411-1076433 CCAGGTGGTCACAGGATGGCTGG - Intronic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
992694060 5:79267289-79267311 AATGGTGTACACAGGACAGCAGG - Intronic
993947290 5:94130991-94131013 CACAGTGGACCCAGGACTGCAGG - Intergenic
996299081 5:121960355-121960377 CTGGGTGGAGACAGGAGAGCAGG - Intergenic
997347704 5:133204071-133204093 CAGGGTGGGGACAGCAAGGCTGG + Intronic
997429633 5:133828653-133828675 CAAGGGGGACACCGGACTGCTGG + Intergenic
998093574 5:139384458-139384480 CAGTGTGGACACCGGCAGGCGGG - Intronic
998519534 5:142787126-142787148 CAGGGTGGGCACAGAACTTCTGG + Intronic
1001982792 5:176047943-176047965 CAATGTGGACACAGGACCACAGG - Intergenic
1002234671 5:177796114-177796136 CAATGTGGACACAGGACCACAGG + Intergenic
1003264999 6:4557942-4557964 CAGGATGGACACTGGAGGACAGG + Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1005889418 6:30124545-30124567 CAGAGTGGGCACAGAACTGCTGG + Intergenic
1007038861 6:38702952-38702974 CAAGGTGGGCACAGGACCGAAGG - Exonic
1007113244 6:39325789-39325811 CAGGGTGGACAAAAGCCTGCAGG - Intergenic
1015121100 6:129702501-129702523 AAGGGTGGGCACAGGACAGAGGG + Intronic
1018940761 6:168307870-168307892 CAGGTTAGACTCAGGACAGCTGG + Exonic
1019453365 7:1111304-1111326 CAGGGAGGACACAGGGTAGCAGG + Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019803402 7:3105127-3105149 GAGGGCGGACACATGAAGGCAGG - Intergenic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1023852438 7:44157912-44157934 CAGGGTGGAAGCAGGGCGTCAGG + Intronic
1025766912 7:64464218-64464240 CAGGGAGGAGACAGGACGCCCGG - Intergenic
1025776166 7:64562716-64562738 CAGGGAGGAGACATGACGCCCGG + Intronic
1025777896 7:64575038-64575060 CAGGGAGGAGACAGGACGCCCGG - Intergenic
1025801943 7:64794758-64794780 CAGGGAGGAGACAGGACGCCTGG - Intronic
1025815093 7:64903610-64903632 CAGGGAGGAGACAGGACGCCCGG - Intronic
1025825315 7:65006328-65006350 CAGGGAGGAGACAGGATGCCCGG + Intronic
1025865157 7:65374190-65374212 CAGGGAGGAGACAGGACGCCCGG - Intronic
1027226472 7:76247061-76247083 CAGTGTGGACACAGGCTGGAGGG + Intronic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1031670211 7:124533599-124533621 CATGGTGGACAAAGGAAGGGAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032795320 7:135271599-135271621 CAGGCTGGACACAGGAGACCTGG - Intergenic
1034843170 7:154418534-154418556 GAGAGTGGACAGGGGACGGCTGG + Intronic
1035361382 7:158316004-158316026 AAGGGTGGCCACAGCAGGGCTGG - Intronic
1035559769 8:595506-595528 CAGGAAGGCCACAGGACAGCAGG + Intergenic
1035973832 8:4284637-4284659 AAGGGTGGACTCAGGACTCCTGG + Intronic
1037751691 8:21686501-21686523 CAGGGTGGCCACTGGACCGAGGG + Intergenic
1039780121 8:40776978-40777000 CAGGCTGGACCCAGGAGGTCAGG - Intronic
1047733864 8:127749011-127749033 CAGAGTGGGCACATGACTGCGGG - Intergenic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048306464 8:133288241-133288263 CAGGGTGAGCTCAGGACAGCTGG - Intronic
1048382104 8:133874281-133874303 CAGGCTGGCCAAAGGAAGGCTGG + Intergenic
1049321968 8:142001429-142001451 CAGCGTCGACACAGGACGAGGGG + Intergenic
1049370126 8:142260433-142260455 AAGGGAGGACAGAGGACGCCTGG - Intronic
1049767761 8:144362852-144362874 CAGGGTGGACAGGAGAGGGCAGG - Intergenic
1052270788 9:26626101-26626123 CAGGTTGGACAGAGGCCTGCAGG - Intergenic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1053196783 9:36125954-36125976 CAGGGTGCTCACAGGACAGAGGG - Intergenic
1056758331 9:89396736-89396758 CCAGGTGGTCACAGGCCGGCTGG + Exonic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1058743429 9:107966689-107966711 CTGGGAGGACAGAGGAGGGCTGG + Intergenic
1058935647 9:109767311-109767333 TAGGGTGGGCACAGGCCGGTGGG - Intronic
1061303765 9:129721212-129721234 GAGGGTGGACACAGGGCGCTGGG - Intronic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1062026105 9:134341554-134341576 CCGGGTGGAGACTGGAGGGCGGG - Intronic
1062138757 9:134944036-134944058 CAGGGTGGAGGCAGAACGGCGGG - Intergenic
1062205737 9:135335875-135335897 CTGGGTGGACACACGAAGGCTGG + Intergenic
1062285645 9:135771430-135771452 AAAGGTGGCCACAGGAAGGCGGG - Intronic
1203761226 EBV:13643-13665 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203762155 EBV:16715-16737 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203763084 EBV:19787-19809 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764013 EBV:22859-22881 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764942 EBV:25931-25953 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203765871 EBV:29003-29025 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203766800 EBV:32075-32097 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203767729 EBV:35147-35169 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1186657397 X:11629714-11629736 CTGAGTGGCCACAGGATGGCTGG + Intronic
1190111217 X:47590315-47590337 CAGGGTGGGGACAGGTTGGCTGG - Intronic
1190120042 X:47651653-47651675 CAGGCTGGAGGCAGGACTGCTGG + Intergenic
1200162123 X:154015006-154015028 CAGGGTGGAAACAGGACCGGAGG + Intronic