ID: 1061368966

View in Genome Browser
Species Human (GRCh38)
Location 9:130187285-130187307
Sequence GACCCAGGGATGGCAGCGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061368966_1061368973 5 Left 1061368966 9:130187285-130187307 CCCGTCGCTGCCATCCCTGGGTC 0: 1
1: 1
2: 3
3: 16
4: 209
Right 1061368973 9:130187313-130187335 GCTCTCTGAGCACCGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061368966 Original CRISPR GACCCAGGGATGGCAGCGAC GGG (reversed) Intronic
900396072 1:2453769-2453791 GACCCAGGGCTGGCATCTGCTGG - Intronic
903953662 1:27011020-27011042 GCCCCAGGCATGGCAGGGAGGGG - Intronic
906107558 1:43304045-43304067 GAGCCAGGGAGGGCAGCCCCAGG - Intronic
907368081 1:53979076-53979098 GAAGGAGGGATGGCAGTGACAGG + Intergenic
910564786 1:88631274-88631296 GAGACAGGGAAGGCAGCAACAGG + Intergenic
918587441 1:186204064-186204086 GGCCCAAGGATGGCAGTGAATGG + Intergenic
919881941 1:201906612-201906634 GGCCCAGGGCTGGAAGGGACCGG + Intronic
920594053 1:207250787-207250809 GACCCAGTGATGACAGGGAAGGG + Intergenic
920960064 1:210656110-210656132 GACCAATGGATGGAAGTGACAGG - Intronic
922478349 1:225922138-225922160 GACCCACGAATGGCAGCTAATGG - Intronic
922763388 1:228145805-228145827 GACCCAGGGAAGGGAGACACAGG - Intronic
924715748 1:246572078-246572100 GTCCCAGGCATGGCTGTGACTGG - Intronic
1068395624 10:56457313-56457335 GTCCCAGTGATGGCAGCAGCAGG - Intergenic
1069725295 10:70573665-70573687 CACCCAGAGAAGGCAGTGACTGG - Intergenic
1069897438 10:71688429-71688451 GAGCCAGGGATGGTAGAGCCAGG + Intronic
1069918337 10:71800773-71800795 GGGCCAGGGATGACAGGGACTGG + Intronic
1071574968 10:86718559-86718581 GACCCAGGGGTGTCAGAGAAGGG - Intronic
1071799324 10:89041987-89042009 GTCCCAGGGATGGAGGCCACAGG - Intergenic
1072662336 10:97370633-97370655 GATCCAGGGAGGGCAGTGATGGG - Intronic
1073057826 10:100713570-100713592 ATCCCAGGGCTGGCAGCGACAGG + Intergenic
1073352290 10:102828437-102828459 GACAGAGGGATGGCAACGGCAGG + Intergenic
1077167919 11:1152099-1152121 GAAACTGGGATGGAAGCGACAGG + Intergenic
1077905576 11:6530290-6530312 GACCCAGGGATAGCAACAATTGG - Intronic
1078107415 11:8366882-8366904 TCCCCAGGGATGGCAGCTACAGG + Intergenic
1078469426 11:11575254-11575276 GAACCAGGGATGGCAGGCTCTGG - Intronic
1083154961 11:60816967-60816989 GACCTGGGGAAGGCAGCAACTGG + Intergenic
1084266615 11:68008425-68008447 GGCCCAGAGAGGGCAGCCACTGG - Intergenic
1084273400 11:68040455-68040477 GACCCAGGGGAGGAAGTGACTGG + Intronic
1084488017 11:69462412-69462434 GGCCCAGGGATAGCAGAGAAGGG + Intergenic
1084503959 11:69553704-69553726 GACCCTGGGAGGGCAGGGCCTGG - Intergenic
1084742470 11:71148510-71148532 GACCCAGGGATGGCAGGGACTGG + Intronic
1084785341 11:71438676-71438698 CTCCCAGGGCTGGCAGAGACAGG + Intronic
1085237326 11:75025206-75025228 GACCCAGGGAGGGAGGCAACTGG + Intergenic
1086468079 11:87075951-87075973 GTCCCAGGGATGGTAGCCACAGG - Intronic
1089189926 11:116646303-116646325 GACCCAGGCAGGGCATCAACAGG + Intergenic
1089642022 11:119853928-119853950 GGCCCACAGAGGGCAGCGACTGG - Intergenic
1090274025 11:125407167-125407189 GACCCAGGGAAGGGAGAGAAGGG + Intronic
1091113893 11:132996027-132996049 GACCCATGGATGGCAGGGGGAGG - Intronic
1091691229 12:2598817-2598839 GAACCAGGGATGGCAGCTGGGGG - Intronic
1092171330 12:6375547-6375569 CGGCCAGGGATGGAAGCGACAGG + Intronic
1094661089 12:32471231-32471253 GGCCCAGGGATGCCAGTGCCTGG - Intronic
1100178339 12:92056520-92056542 GACCCTGGAAGGGCAGAGACAGG - Intronic
1100442522 12:94629704-94629726 GACCCAGGGATGGGAGCTCATGG - Intronic
1103447637 12:121004548-121004570 GACCAAGGGAGGACAGCGAGAGG - Intronic
1104037924 12:125111027-125111049 AACCCAGGGGTGGGAGCGAGGGG + Intronic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1105558925 13:21472687-21472709 GTCCCAGTGATGGTAGCCACAGG - Intergenic
1107098276 13:36560197-36560219 GACCCAGGGAGGACAGCAGCAGG - Intergenic
1108450464 13:50557536-50557558 GCCACAGGGGTGACAGCGACAGG - Intronic
1113583885 13:111449498-111449520 GACCCACAGGTGGCAGGGACTGG + Intergenic
1115261786 14:31461863-31461885 GACCCAGGGCTAGCAACAACAGG + Intergenic
1117478376 14:56118995-56119017 GACCCAGCGGGGGCAGCGCCGGG + Intronic
1117896734 14:60495257-60495279 GACCCAGAAATTGCAGCAACTGG - Intronic
1118378283 14:65196264-65196286 GACCGAGGCATGTCAGTGACGGG + Intergenic
1119539569 14:75429078-75429100 GACCCTGGGATGGCAGAGCCAGG + Intronic
1120439573 14:84519854-84519876 GTCCCAGTGGTGGCAGCCACAGG - Intergenic
1122287491 14:100660250-100660272 GTCCCGGGGAGGGCAGCCACAGG - Intergenic
1125509199 15:40283583-40283605 GAGCTAGGGGTGGCAGCGAAAGG + Intronic
1128548263 15:68581542-68581564 GGCCCAAGGATGGAAGTGACTGG - Intronic
1128566695 15:68705484-68705506 GACCCAGGGAGGGAAGTGGCTGG + Intronic
1130096068 15:80857173-80857195 AACCCAGGAAGGGCAGAGACAGG - Intronic
1132571507 16:646406-646428 GCCCCAGGGCTGGCAGGGTCTGG - Intronic
1132794419 16:1712417-1712439 GACCCTGGGATGGTGGTGACTGG - Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1132904210 16:2273891-2273913 GGCCCAGGGATAGGAGTGACCGG - Intergenic
1133212350 16:4270744-4270766 GGCCCAGGCATGGCAGCCAGAGG + Intronic
1133319082 16:4902048-4902070 CACCCAGGAAAGGGAGCGACAGG + Intronic
1133773708 16:8882532-8882554 GGGCCAGGGCTGGCAGGGACCGG + Intergenic
1135173632 16:20208954-20208976 TGCCCAGGGATGGTAGTGACTGG - Intergenic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1138023375 16:53503707-53503729 GACCTAGCGATGGGAGCCACTGG - Intronic
1138202725 16:55101973-55101995 GACCCAGAGAAGGCAGGGATAGG + Intergenic
1139648606 16:68349975-68349997 GCCCCAGGCCTGGCAGCCACTGG + Intronic
1139655030 16:68382363-68382385 CACCCAGGGCTGGCAGGGGCAGG + Intronic
1140593123 16:76376709-76376731 GACCCAGGGTTGGAATCCACAGG + Intronic
1141697666 16:85627860-85627882 GACACAGGGATGGCGGGGAGAGG - Intronic
1142433582 16:90043537-90043559 CACCCAGGGAAGGGAGCGACAGG - Exonic
1142619298 17:1154677-1154699 GACACAGGGAAGGAAGCCACAGG + Intronic
1145106742 17:20124116-20124138 GAGCCAGGGATGTCAGGGAATGG + Intronic
1147339682 17:39746024-39746046 GACCCAGGGATAAGAGAGACTGG + Intronic
1147837772 17:43347236-43347258 GACCCTGGGGTGGCAGGTACTGG + Intergenic
1150857229 17:68764806-68764828 TACCCAGGAATGTCAGCTACAGG + Intergenic
1151455349 17:74222481-74222503 GCCCCAGGAACAGCAGCGACTGG - Exonic
1152302303 17:79502340-79502362 GTGCCAGGGATGGCAGGGAGGGG + Intronic
1154293723 18:13132115-13132137 GACCCAGTGACGGCAGGGATGGG - Intergenic
1155177090 18:23310384-23310406 GTCTCAGGAATGGCAGCCACAGG + Intronic
1156135575 18:34032819-34032841 GCCCCAGTGATGGCAGCAATGGG - Intronic
1156888742 18:42165647-42165669 CAGCCAGGCATGGCAGAGACTGG + Intergenic
1157113498 18:44842690-44842712 GACCCAAGGGTGGCAGAGGCAGG + Intronic
1157404256 18:47410191-47410213 GACCCTGGGATAGCAGTGCCTGG + Intergenic
1157594245 18:48854233-48854255 GAAGCAGGGAGGGCAGGGACTGG + Intronic
1157653042 18:49356614-49356636 GACCCATGGTTGGCAACGAAGGG - Intronic
1158062846 18:53366907-53366929 CACCCAGAGATGGAAGCCACAGG + Intronic
1159945353 18:74440967-74440989 GACCCTGGGGTGGCAGAGTCGGG + Intronic
1161219906 19:3113723-3113745 GACCCAGGGAGGGCAGCGGCAGG - Intronic
1161946340 19:7439693-7439715 GACCCAGAGATGGCAGGGCATGG - Exonic
1162003017 19:7760089-7760111 GTCCCAGTGGTGGCAGCGGCAGG + Intergenic
1162524087 19:11197495-11197517 GACCCAGGGAAGGCAGCGGCCGG - Exonic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163375544 19:16928035-16928057 GACCCAGGGATGGCGCCGTGTGG + Exonic
1164305762 19:24003139-24003161 GACCCAGGCGTGGCAGCCAGGGG + Intergenic
1164594027 19:29521897-29521919 GAGCCAGGCTTGGCAGAGACTGG + Intergenic
1165423755 19:35734519-35734541 GAGCCATGGATGGCAGGGAAGGG + Intronic
1165862714 19:38917683-38917705 GATCCAGGGATGGCAGGGGTGGG - Intronic
1166726115 19:45028791-45028813 GCCCCGGGGATGGCACCCACTGG + Intronic
1167321535 19:48799826-48799848 CACCCAGCGAGGGCTGCGACGGG + Exonic
1167596325 19:50430183-50430205 TAGCCAGGGATGGCAGCGACTGG - Exonic
1168283702 19:55320220-55320242 GACCCAGGGAGGGAAGTGAGGGG + Intronic
927420154 2:22922492-22922514 GATCCAGAGATGGAAGCCACAGG - Intergenic
927990402 2:27443060-27443082 GACCCAGTGCTGGCAGGGACAGG - Exonic
929093497 2:38242525-38242547 GACCCAGATATGGCATCCACAGG + Intergenic
930161086 2:48156448-48156470 GCACCAGTGATGGCAGTGACTGG - Intergenic
932621221 2:73265786-73265808 GACCCAGGGAGGGTAGGGGCAGG + Intronic
932688971 2:73896512-73896534 GGCCCAGGGAAGGAAGGGACTGG + Intronic
934103434 2:88674835-88674857 GAGCCAGGGAAGGCCGCGAAAGG - Intergenic
938108601 2:128549812-128549834 AACCCAGGGACCGCAGCGAGCGG + Intergenic
938125107 2:128665462-128665484 GACCCAGGAAGGGCAGGGACAGG - Intergenic
944680566 2:202073174-202073196 AACCCAGGCAAGGCAGAGACGGG - Intergenic
945046566 2:205787153-205787175 GACCCAGGGAGGTCAATGACTGG + Intronic
945288096 2:208102545-208102567 GACCCAGTGATGGTAACGAGGGG - Intergenic
946177861 2:217932850-217932872 GGCCCCTAGATGGCAGCGACAGG + Intronic
946360757 2:219218265-219218287 GAGCCAGGCACGGCAGCGTCTGG - Exonic
946401969 2:219472970-219472992 GAGCCAGGGTGGGCAGCCACAGG + Exonic
947156316 2:227165061-227165083 GAGTCAGGGATGGCGGGGACAGG + Intronic
947904121 2:233747314-233747336 TACCCATTGATGGCAGCCACTGG + Intronic
947918525 2:233850151-233850173 GGCCCAGGGATGACAGGGACTGG + Intronic
948172956 2:235920337-235920359 AACCCAGGGATGGGAGGGAAGGG + Intronic
1171273403 20:23834373-23834395 GCACCAGGGAGGGCAGGGACAGG - Intergenic
1173229633 20:41184028-41184050 GACCCTGGGGTGGGAGCCACGGG + Exonic
1173865000 20:46307911-46307933 GGCCGAGGGGTGGCAGCGCCAGG - Intronic
1174582345 20:51580768-51580790 GACCTAGGGTTGGCTGTGACTGG - Intergenic
1175269431 20:57723465-57723487 GACCCAGAGGAGGCAGAGACTGG + Intergenic
1175822621 20:61918497-61918519 GCCCCAGGGGTGGCAGAGTCAGG + Intronic
1176270988 20:64235440-64235462 GACCCTGGGATGGCCGCGGTGGG + Intronic
1176271129 20:64235891-64235913 GACCCTGGGATGGCCGCGGTGGG + Intronic
1176271155 20:64235963-64235985 GACCCTGGGATGGCCGCGGTGGG + Intronic
1176271277 20:64236299-64236321 GACCCTGGGATGGCCGCGGTGGG + Intronic
1176271295 20:64236347-64236369 GACCCTGGGATGGCCGCGGTGGG + Intronic
1179445386 21:41426858-41426880 GCCCCAGGCATGGCATCCACTGG - Intronic
1179901778 21:44397931-44397953 GACCCAGGGATGGGAACTCCAGG - Intronic
1181456363 22:23062245-23062267 GACCCAGGGGTGTCAACCACAGG + Intronic
1181493787 22:23276680-23276702 GCCCCAGGAATGGCAGGGGCAGG - Intronic
1181762584 22:25068251-25068273 GCCCCAGCGATGGCAGAGCCAGG - Intronic
1182452819 22:30431251-30431273 TAGCCAGGTATGGCAGGGACTGG - Intergenic
1182567312 22:31210060-31210082 GATTCAGGGAGGGCAGAGACTGG + Intergenic
1183922113 22:41177652-41177674 GAGCCAGGGATGGGACCGACAGG + Exonic
1183924938 22:41198971-41198993 GACACTGGGATGGTAGCAACCGG + Intergenic
1184177003 22:42794218-42794240 GGCCCAGGGATGGCGGCCAGAGG - Intergenic
1184834497 22:47013133-47013155 GATCCTGGGAAGGAAGCGACTGG - Intronic
1185229306 22:49671023-49671045 GACGCAGGGACGGCAGGGGCCGG - Intergenic
950543194 3:13624508-13624530 GACCCGGGGATGGCTGGGAATGG - Intronic
952416503 3:33095588-33095610 GCCTCAGGTATGGCAGCCACAGG + Intronic
953785300 3:45906877-45906899 GAGCCAGGGATGGGAGAGGCAGG - Intronic
954379708 3:50213064-50213086 GACCCAGTGATGGGAGAGAGGGG + Intronic
956710471 3:72034821-72034843 AACCCAGAGATGGCAGCTTCTGG + Intergenic
957166611 3:76682145-76682167 GAACCAGGGATGGCAGGGGGTGG + Intronic
957719643 3:83977561-83977583 GAACAATGGATGGCAGAGACTGG - Intergenic
961125068 3:124409943-124409965 GACCCAGGGAGGGCAGCCTTAGG + Intronic
961225353 3:125239909-125239931 GACCCAGGGCTGGAAGGGAGTGG + Intronic
961359108 3:126356473-126356495 GACCGAGGGATGGCGGCGGCGGG - Intronic
963330063 3:143904330-143904352 GACCAAGGGATGGCAGGAAGGGG - Intergenic
968018125 3:195357564-195357586 GTCCCAACGATGGCGGCGACAGG + Intronic
968600840 4:1508602-1508624 GACCCAGGGTGGGCAGAGCCCGG - Intergenic
969520513 4:7675377-7675399 GGCTCAGGGCTGGCAGGGACCGG + Intronic
974625085 4:64415972-64415994 GACCCTGGGATGTCAGTAACAGG + Intergenic
981819908 4:148874539-148874561 AACCCAGGGCTGGCAGCAGCAGG + Intergenic
986270576 5:6227325-6227347 GACTGAGTGATGGCAGCCACTGG - Intergenic
986506528 5:8457776-8457798 GACCCGGGGATCGCAGCCTCCGG - Intergenic
987225598 5:15837701-15837723 GAGCCAAGGATGGCAGCCAGAGG + Intronic
987645972 5:20672626-20672648 GTCCCAGTGGTGGCAGCCACAGG + Intergenic
992396534 5:76374000-76374022 GACTTTGGGATGGCAGGGACAGG - Intergenic
999362972 5:151001666-151001688 GAGCCATGGATGGCAGAGGCCGG + Intergenic
999720855 5:154398386-154398408 GCTCCAGGGATGGCAGCAGCTGG - Intronic
1002181980 5:177435411-177435433 GGCACAGGGAGGGCAGGGACTGG - Intronic
1002622804 5:180501009-180501031 GACACAGGGATGAGAGGGACAGG + Intronic
1006404842 6:33838924-33838946 GACCCAGGGTAGGTAGAGACTGG + Intergenic
1006948042 6:37798537-37798559 AACCCAGGGAGGGCTGCGGCAGG + Intergenic
1007065880 6:38990110-38990132 TATCTAGGGATGGCAGTGACTGG - Exonic
1009716941 6:67409901-67409923 GACCCAGGGAAGGCAGCATGAGG - Intergenic
1010062070 6:71635074-71635096 GCCCCAGTGGTGGCAGCAACAGG - Intergenic
1012892219 6:104908948-104908970 GTCCCAGTGGTGGCAGCCACAGG + Intergenic
1013318837 6:108967170-108967192 GACACAGGGAGGGCAGCAAGTGG - Intronic
1013368019 6:109449399-109449421 GATACAGGGATGCCAGCCACCGG - Exonic
1016864159 6:148748571-148748593 GAGCCAGGGGTGCCAGGGACAGG + Intronic
1018349795 6:162944088-162944110 GCCCCAGTGGTGGCAGTGACGGG - Intronic
1018996778 6:168716266-168716288 GAGCCTGGGATGGCAGACACAGG - Intergenic
1019080117 6:169424686-169424708 AACCCAGGGATGGGAGAGATTGG - Intergenic
1019212110 6:170414946-170414968 GACACAGGCATGGCAGGGACTGG + Intergenic
1019616207 7:1963720-1963742 CACCCAGGGAGGGCAGCGCACGG - Intronic
1019687240 7:2388660-2388682 GACGCAGGGATGGCAGGGGCAGG - Intergenic
1024995994 7:55273599-55273621 TGCCCAGGGATGTCAGAGACTGG + Intergenic
1027177088 7:75911420-75911442 GTCCCAGGGGTGGCTGAGACAGG - Intronic
1027553856 7:79637493-79637515 TCCCCAGGGAAGGCACCGACTGG + Intergenic
1032239985 7:130153196-130153218 CAGCCAGGGGTGGCAGCCACTGG + Intergenic
1034139095 7:148800020-148800042 GACTCAGGGGTGGCATTGACAGG + Intronic
1035252535 7:157606446-157606468 CAGCCAGGGATGGCAGTGACAGG - Intronic
1035392464 7:158514356-158514378 GACCCCAGGATGGCAGCAAAGGG + Intronic
1035747692 8:1973944-1973966 GACCCCGGGGAGGCAGCGGCGGG + Intronic
1036532935 8:9613044-9613066 GTCTCAGGGGTGGCAGAGACAGG + Intronic
1036736142 8:11318332-11318354 GAACCAGGGATGACAAGGACAGG - Intronic
1037164783 8:15813409-15813431 ACCCCAGAGATGGCAGAGACAGG - Intergenic
1038801578 8:30754167-30754189 GAGCCAGAGATGGCAGTGAGTGG + Intronic
1043880325 8:85535188-85535210 GTCCCAGGGAGGGCTGCGAGAGG + Intergenic
1047199058 8:122748571-122748593 GACCCAGGGTTGAGAGCCACTGG + Intergenic
1048343027 8:133555306-133555328 GAGCCAGGGATGACAACGGCAGG - Intronic
1049217232 8:141413773-141413795 GCCGCAGGGAGGGCAGTGACTGG + Intronic
1049244711 8:141556157-141556179 GACCCAGGAAAAGCAGCAACTGG - Intergenic
1049411793 8:142476900-142476922 GGCCCAGGGATGGCACAGGCCGG + Intronic
1049619195 8:143590176-143590198 TGCCCAGGGAGGGCAGCCACGGG - Intronic
1049690230 8:143955083-143955105 GTCCCAGGGAGGGCAGGGACGGG - Intronic
1049862137 8:144906539-144906561 GACCCAGGGATGGGGGCGTTTGG - Intergenic
1050286449 9:4107389-4107411 GATCCAGGCATGGAAGTGACAGG - Intronic
1053064908 9:35061257-35061279 GACCCAGGGATAGCAGTCAGGGG - Intronic
1053445454 9:38149855-38149877 GAGCCAGTGATTGCAGAGACAGG - Intergenic
1055891600 9:81129963-81129985 GTCTCAGGGATGGCAGAGGCAGG - Intergenic
1056756267 9:89383873-89383895 GGCCCAGGGAAGGCGGAGACAGG - Intronic
1059451285 9:114372800-114372822 GATCCAGGGTTGGAAGAGACGGG - Intronic
1059536537 9:115086207-115086229 GCCCCAGGGACTGCAGCAACAGG - Exonic
1061046132 9:128166162-128166184 GACCCAGGCAGGCCAGGGACAGG + Exonic
1061368966 9:130187285-130187307 GACCCAGGGATGGCAGCGACGGG - Intronic
1061755790 9:132811646-132811668 TACCCAGAGATGGCAAAGACAGG + Intronic
1061866213 9:133492991-133493013 GGCTCAGGGGTGGCAGGGACTGG + Intergenic
1185432050 X:17171-17193 CAGCCAGGGAAGGCAGCTACTGG + Intergenic
1185441366 X:229885-229907 CAGCCAGGGAAGGCAGCTACTGG + Intergenic
1186102620 X:6173086-6173108 GACCCAGAGATGTCAGAGAGTGG - Intronic
1188154450 X:26723287-26723309 GCGCCAGTGGTGGCAGCGACAGG - Intergenic
1190063673 X:47226251-47226273 GACCCAGGAATGGCAGGCAGAGG - Intronic
1191015465 X:55805238-55805260 GAGCCAGGTATGGCAGAGACTGG - Intergenic
1198995131 X:142566181-142566203 GTCCCAGTGATGACAGCCACAGG - Intergenic