ID: 1061379057

View in Genome Browser
Species Human (GRCh38)
Location 9:130243465-130243487
Sequence AAGACAATGTCGTCGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061379057_1061379065 1 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379065 9:130243489-130243511 GGTCAGACACAGGGAGCTGGGGG No data
1061379057_1061379063 -1 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379063 9:130243487-130243509 TTGGTCAGACACAGGGAGCTGGG No data
1061379057_1061379060 -9 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379060 9:130243479-130243501 CATTGTCTTTGGTCAGACACAGG No data
1061379057_1061379064 0 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379064 9:130243488-130243510 TGGTCAGACACAGGGAGCTGGGG No data
1061379057_1061379066 29 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379066 9:130243517-130243539 GCTTCTATTAAGTTCAGATCCGG No data
1061379057_1061379062 -2 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379062 9:130243486-130243508 TTTGGTCAGACACAGGGAGCTGG No data
1061379057_1061379061 -8 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379061 9:130243480-130243502 ATTGTCTTTGGTCAGACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061379057 Original CRISPR AAGACAATGTCGTCGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr