ID: 1061379066

View in Genome Browser
Species Human (GRCh38)
Location 9:130243517-130243539
Sequence GCTTCTATTAAGTTCAGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061379059_1061379066 22 Left 1061379059 9:130243472-130243494 CCGACGACATTGTCTTTGGTCAG No data
Right 1061379066 9:130243517-130243539 GCTTCTATTAAGTTCAGATCCGG No data
1061379057_1061379066 29 Left 1061379057 9:130243465-130243487 CCAGGCTCCGACGACATTGTCTT No data
Right 1061379066 9:130243517-130243539 GCTTCTATTAAGTTCAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061379066 Original CRISPR GCTTCTATTAAGTTCAGATC CGG Intergenic
No off target data available for this crispr