ID: 1061382748

View in Genome Browser
Species Human (GRCh38)
Location 9:130268239-130268261
Sequence CTCAGTGCCCAGAGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061382748_1061382754 7 Left 1061382748 9:130268239-130268261 CCCTCTCCTCTCTGGGCACTGAG No data
Right 1061382754 9:130268269-130268291 GCAGTTCTCCAGCCTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061382748 Original CRISPR CTCAGTGCCCAGAGAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr