ID: 1061385621

View in Genome Browser
Species Human (GRCh38)
Location 9:130287754-130287776
Sequence CTGGGTAAATAGCTGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061385619_1061385621 -6 Left 1061385619 9:130287737-130287759 CCAGCTCAGAGCAGGTGCTGGGT 0: 1
1: 0
2: 5
3: 49
4: 349
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385609_1061385621 30 Left 1061385609 9:130287701-130287723 CCCGATGGCCACAGCCTTCCCAG 0: 1
1: 0
2: 0
3: 36
4: 327
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385610_1061385621 29 Left 1061385610 9:130287702-130287724 CCGATGGCCACAGCCTTCCCAGC 0: 1
1: 0
2: 5
3: 41
4: 455
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385614_1061385621 11 Left 1061385614 9:130287720-130287742 CCAGCACTTTACATTTCCCAGCT 0: 1
1: 0
2: 1
3: 25
4: 267
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385612_1061385621 16 Left 1061385612 9:130287715-130287737 CCTTCCCAGCACTTTACATTTCC 0: 1
1: 0
2: 2
3: 24
4: 294
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385617_1061385621 -5 Left 1061385617 9:130287736-130287758 CCCAGCTCAGAGCAGGTGCTGGG 0: 1
1: 3
2: 13
3: 115
4: 728
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385613_1061385621 12 Left 1061385613 9:130287719-130287741 CCCAGCACTTTACATTTCCCAGC 0: 1
1: 1
2: 2
3: 26
4: 244
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data
1061385611_1061385621 22 Left 1061385611 9:130287709-130287731 CCACAGCCTTCCCAGCACTTTAC 0: 1
1: 0
2: 1
3: 68
4: 772
Right 1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061385621 Original CRISPR CTGGGTAAATAGCTGGTGAA TGG Intronic
No off target data available for this crispr