ID: 1061386365

View in Genome Browser
Species Human (GRCh38)
Location 9:130292411-130292433
Sequence TGCCCACTCATAAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061386365_1061386370 27 Left 1061386365 9:130292411-130292433 CCTCCCACATTTATGAGTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1061386370 9:130292461-130292483 ATCAAAAGTGACGGATAATTTGG No data
1061386365_1061386369 18 Left 1061386365 9:130292411-130292433 CCTCCCACATTTATGAGTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1061386369 9:130292452-130292474 CTTTTATGCATCAAAAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061386365 Original CRISPR TGCCCACTCATAAATGTGGG AGG (reversed) Intronic
900498899 1:2990064-2990086 TGCCCAGGCCAAAATGTGGGTGG + Intergenic
900651070 1:3730319-3730341 TGCCCACTCCTGGCTGTGGGAGG + Intronic
903379886 1:22889322-22889344 TGCCCACTTAGAGATGTTGGAGG - Intronic
904051346 1:27641154-27641176 TGCCCACTAATAAATATAGAGGG + Intergenic
906673208 1:47675409-47675431 TGCCCACTGAAAAGTGTTGGTGG + Intergenic
909418066 1:75430076-75430098 TTCCAACACATAAATGTTGGGGG - Intronic
910735052 1:90444442-90444464 TGACAACTAGTAAATGTGGGAGG + Intergenic
911434873 1:97844698-97844720 TGCCAACTCAGAAGTGTGTGGGG - Intronic
919966703 1:202534021-202534043 TGCCTACTAATAAATGTAGAAGG - Intronic
920727148 1:208446591-208446613 AGCCCACGCAGAAAGGTGGGAGG - Intergenic
921841281 1:219831246-219831268 TGCCAATTCATAAATGTAGAAGG - Intronic
1063645925 10:7883662-7883684 TGCCAACTGATAAATGTAGAAGG - Intronic
1063939705 10:11115069-11115091 TGGCCCCACATAAATGTGTGGGG + Intronic
1065234672 10:23637068-23637090 AGCCCACTAATAAAGGTTGGTGG - Intergenic
1068517764 10:58045291-58045313 TCCCCTCTCATAACTGTGGTGGG - Intergenic
1068580649 10:58735600-58735622 TTCCCAATCATAAATGGGGATGG - Intronic
1068983080 10:63081936-63081958 TTGACACTGATAAATGTGGGTGG - Intergenic
1072422296 10:95299228-95299250 TGCCAACTAATAAATGTAGGGGG + Intergenic
1073493115 10:103868082-103868104 AGCAAACTCATACATGTGGGTGG + Intergenic
1073524822 10:104170489-104170511 TGACCACTCAGCAATGTGTGTGG - Intronic
1074918388 10:117981635-117981657 GACCCACTCTTAAATTTGGGTGG + Intergenic
1075994574 10:126866879-126866901 TGTCCACTAATATTTGTGGGTGG + Intergenic
1082280293 11:50264223-50264245 TGCCAGCTAATAAATGTGGAAGG + Intergenic
1083085968 11:60145860-60145882 TCACCACTCATAACTGTGTGTGG + Intergenic
1084302661 11:68261641-68261663 TGCGGACTCAGAAATGTGAGGGG - Exonic
1089664289 11:120007991-120008013 GCCCCAGTCATAAATGTAGGAGG - Intergenic
1091109750 11:132954884-132954906 TGCCCACACAGAAATCAGGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095758621 12:45800997-45801019 TGCCAACTAATAAATGTTGAAGG + Intronic
1096374955 12:51101330-51101352 TGGTCATTCTTAAATGTGGGTGG - Intronic
1097251434 12:57634604-57634626 TGCCAATTAATAAATGTGGAGGG + Intergenic
1099615249 12:84926445-84926467 TGCCAACTAATAAATGTTGATGG + Intergenic
1101812019 12:108115532-108115554 TGCCCACTCATGACAGAGGGAGG - Intergenic
1104979478 12:132567391-132567413 TGCCCACACACAAGTCTGGGTGG - Intronic
1110719292 13:78743681-78743703 TCCTCCCTCATGAATGTGGGAGG + Intergenic
1113393008 13:109916077-109916099 TGCCCACTGAAAAATGTGAGTGG - Intergenic
1115019463 14:28658515-28658537 TGCCCTTTAATAGATGTGGGTGG - Intergenic
1115475230 14:33807029-33807051 TGGCCATCCATAAATGTTGGAGG + Intergenic
1116430602 14:44841499-44841521 TCCCCCCTCAAAAATGTGGGTGG + Intergenic
1116643767 14:47500107-47500129 TCCCCACACATAAATCTGTGTGG + Intronic
1117266877 14:54098201-54098223 TTCCAACACATAAATTTGGGGGG + Intergenic
1117813251 14:59570669-59570691 TGACCAATCATGAATGCGGGTGG + Intronic
1119954572 14:78782930-78782952 TTTCAACTCATAAATGTAGGAGG + Intronic
1121142268 14:91554192-91554214 TGCCCACTTAAAAAATTGGGAGG - Intergenic
1124800673 15:32829882-32829904 TACCCACACAGAAATGAGGGGGG + Intronic
1127465718 15:59242553-59242575 TACCAACTAATAAATGTGGAAGG + Intronic
1130075558 15:80686156-80686178 TTCACCCTCATTAATGTGGGAGG - Intronic
1131655725 15:94456540-94456562 TGCCCATTAATAGATGTCGGTGG + Intronic
1132164822 15:99575764-99575786 TGCCCACTAATAAATGGAGAGGG - Intronic
1140030642 16:71335495-71335517 TGGCAACTCAAAAATGGGGGAGG - Intergenic
1141584197 16:85022195-85022217 TGTCAACTAATAAATGTAGGTGG + Intergenic
1144522407 17:15962379-15962401 TGCAAACTGATAAATGTGGAAGG - Intronic
1146891178 17:36507394-36507416 TGCTCCCTCATAAATGAGGTGGG - Exonic
1150577331 17:66441902-66441924 ACTCCACTAATAAATGTGGGTGG + Intronic
1150930772 17:69582428-69582450 AGTTCACTCATAAATGTAGGAGG - Intergenic
1152462764 17:80450082-80450104 TGGCCACTCATCCGTGTGGGAGG - Intergenic
1158861748 18:61599099-61599121 TACACACTTATTAATGTGGGAGG - Intergenic
1159370195 18:67518563-67518585 TACTCTCTCATAAATGTGGTTGG - Intergenic
1159403136 18:67963298-67963320 TTCCCAGTCAGAAATGTGGATGG + Intergenic
1159483473 18:69022271-69022293 TGCCCACATATATATGTGTGTGG - Intronic
1165295615 19:34923393-34923415 TGAACAATCATAAATGTGGAGGG - Intergenic
925690604 2:6519076-6519098 GGCCCACTCCATAATGTGGGTGG - Intergenic
931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG + Intergenic
932501870 2:72189615-72189637 TGACAACTCATAAATGTGCAAGG - Intronic
933106314 2:78330385-78330407 TGACCACCCATCAAAGTGGGTGG - Intergenic
933175342 2:79167386-79167408 TGCCCACTCCAAACAGTGGGAGG - Intergenic
936064944 2:109323714-109323736 TGCCCACTCTTACAGGAGGGTGG - Intronic
937233706 2:120417878-120417900 TGCCCACCCTTAAATATGGGAGG - Intergenic
939639431 2:144621347-144621369 TGGCCAGGCATAAAGGTGGGTGG + Intergenic
941525553 2:166602347-166602369 TACCCACTCACCAATGTGAGTGG - Intergenic
944360785 2:198853614-198853636 TGCCCACGTTTTAATGTGGGTGG - Intergenic
944362753 2:198877594-198877616 TGCCCAGGCAGAAATGTGGTTGG + Intergenic
945480069 2:210335224-210335246 TTCTCACTCATAAATGGGAGTGG + Intergenic
947957426 2:234204754-234204776 TGGCAACTCATAAATGTAGAAGG - Intergenic
1169291559 20:4357643-4357665 TGCCCACCCAAAATTGAGGGTGG - Intergenic
1174539361 20:51276851-51276873 TGCCCACTCCTAAAAATTGGAGG - Intergenic
1175599476 20:60261228-60261250 TTCACACTCACAAAGGTGGGAGG - Intergenic
1175802707 20:61810243-61810265 TACCCACACATCCATGTGGGTGG - Intronic
1177521419 21:22232814-22232836 TTCCAACACATAAATGTAGGGGG - Intergenic
1179070236 21:38064396-38064418 TGCCCAAGCATCACTGTGGGGGG - Intronic
1181098671 22:20524006-20524028 TACCCATTCCTACATGTGGGTGG + Intronic
1183961540 22:41414312-41414334 GGCCCAGGCACAAATGTGGGTGG - Intergenic
1184448155 22:44565756-44565778 TCCACCCTTATAAATGTGGGTGG + Intergenic
954581108 3:51703393-51703415 TGGCCCTTAATAAATGTGGGGGG + Intronic
955757614 3:62241357-62241379 TGCCCACCCATATATTTGTGTGG + Intronic
955900427 3:63747807-63747829 TGCCTACTTTTAAAAGTGGGTGG + Intergenic
959400846 3:105900352-105900374 TGGACACTCAGAAATGTGGGAGG + Intergenic
961310261 3:125993435-125993457 TGCCAACTAATAAATGTAGAAGG + Intergenic
961313998 3:126022001-126022023 TGCCCAGGCATGGATGTGGGGGG + Intronic
962105680 3:132386357-132386379 TGCCTACTCTTAAAAGTGTGGGG + Intergenic
962833405 3:139163974-139163996 TTCCAGCTCATAAATGTGGAGGG - Intronic
966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG + Intronic
970624607 4:17863007-17863029 TGCCCACTTTTTAATGTGGTTGG - Intronic
972772755 4:42213330-42213352 TGTTCACTTATAAATGTGGATGG + Intergenic
973733317 4:53844853-53844875 TGGCCTCACTTAAATGTGGGTGG - Intronic
976307590 4:83576366-83576388 TGCCAAATAATAAATGTGGAAGG + Intronic
976916176 4:90377307-90377329 TACCTAGTCATAAATGTTGGTGG - Intronic
977412358 4:96684243-96684265 TGCCCACTTTTTAATGGGGGTGG + Intergenic
978417396 4:108490947-108490969 TGCCCACACATACATTGGGGAGG + Intergenic
980689360 4:136274369-136274391 TGCCCACACATAATGGTGGGAGG - Intergenic
985484289 5:140138-140160 TGCCCCCTGAGAACTGTGGGGGG + Intergenic
986717375 5:10533827-10533849 TTCCCACCCAGAACTGTGGGAGG - Intergenic
992160783 5:73999140-73999162 TCGCCACACATTAATGTGGGAGG - Intergenic
992437459 5:76769233-76769255 TGCCCACTTTTAAATGGGGTTGG - Intergenic
992667875 5:79028846-79028868 CACCCACTTATAAATTTGGGGGG + Intronic
992987811 5:82251423-82251445 TGCCAACACTTAAATGTAGGAGG + Intronic
995446736 5:112252971-112252993 GGCTGACTCATAAATGTGGAGGG + Intronic
995452639 5:112319384-112319406 TGCCAACTAATAAATGTAGAAGG + Intronic
996270542 5:121599110-121599132 TGCCCTCTCTTTAATGTGGTTGG + Intergenic
997623098 5:135313161-135313183 TGCCAACTGATCAATGTGGAAGG + Intronic
998975825 5:147645621-147645643 TGCTCACTCTTAATTATGGGTGG - Intronic
999859819 5:155633461-155633483 TGCCCACTCCACAAAGTGGGAGG - Intergenic
1002102823 5:176865756-176865778 AGCCCACTCATTCATGTGTGGGG + Intronic
1004108301 6:12687363-12687385 TGTCAACTAATAAATGTGGAAGG + Intergenic
1005049809 6:21674271-21674293 TGCCCACTTCTAAATCTGGAAGG - Intergenic
1005088683 6:22033815-22033837 TCCCCCTTCCTAAATGTGGGAGG - Intergenic
1005225762 6:23639997-23640019 TGCCCACTCAAGATTGAGGGTGG + Intergenic
1008621829 6:53278529-53278551 TCCCCACCCATAAATGGGGCAGG + Intronic
1008690389 6:53972181-53972203 TGACCACTCATGACTGAGGGAGG - Intronic
1011545708 6:88479566-88479588 TGCCATCTCATATTTGTGGGTGG - Intergenic
1013575128 6:111475970-111475992 TCCCTACTCATAAATGAAGGTGG + Intronic
1015728858 6:136327489-136327511 TGCCCCTTAATAAATGTGTGTGG + Intergenic
1015742898 6:136476918-136476940 AGCCAACTAATAAATGTGGAAGG + Intronic
1017313814 6:153004883-153004905 TGTCCACTGATAAATATTGGTGG + Exonic
1020260346 7:6527274-6527296 TGCCCACTCAGATATCTGGCAGG + Intronic
1021790223 7:24197260-24197282 TGCCTACCCCTTAATGTGGGGGG - Intergenic
1022650456 7:32269307-32269329 TTGCTACTCATAAATGTGGTCGG - Intronic
1022896239 7:34752601-34752623 TGGACACTCATAATTGTGGCAGG - Intronic
1027410950 7:77917055-77917077 TGCCGACTAATAAATGTAGAAGG - Intronic
1028820888 7:95210919-95210941 TTCTCACTCATAAGTGTGAGTGG + Intronic
1029493478 7:100884679-100884701 GGCCCTCTGATAAAGGTGGGAGG + Intronic
1030138281 7:106280285-106280307 TGCTCAACCAAAAATGTGGGAGG - Intronic
1030575039 7:111275209-111275231 TGCCCACTCATAAGAGGTGGAGG + Intronic
1035070547 7:156141794-156141816 TGCACAGTCTTAAATGTTGGGGG - Intergenic
1036534678 8:9635397-9635419 TGCCTACTAATCAATGTGGAGGG + Intronic
1038172608 8:25151176-25151198 TGCCAACTGATAAATGTGGATGG + Intergenic
1038643542 8:29346138-29346160 AGGCCACTGATGAATGTGGGGGG - Intronic
1042170588 8:65987182-65987204 TGGAGACTCAGAAATGTGGGAGG + Intergenic
1044202697 8:89454944-89454966 GACCCACTCTTAAATCTGGGTGG + Intergenic
1051907835 9:22116960-22116982 TGACCTCACATAAATATGGGAGG + Intergenic
1051949990 9:22620056-22620078 TCCACCCTCATGAATGTGGGTGG - Intergenic
1058188761 9:101887752-101887774 ATCACACTCATAAATGTGCGTGG - Intergenic
1058453494 9:105118095-105118117 TGGAAACTCAGAAATGTGGGAGG - Intergenic
1061386365 9:130292411-130292433 TGCCCACTCATAAATGTGGGAGG - Intronic
1189064700 X:37795004-37795026 TGCCCAATGATATATGAGGGTGG + Intronic
1195726372 X:107921601-107921623 TGCCAACTTGAAAATGTGGGAGG - Intronic
1198495851 X:137192337-137192359 TGCTCACTAATAAATGTAGTGGG + Intergenic
1202302320 Y:23429789-23429811 TGCCTACTAATAAATGTAGAAGG - Intergenic
1202568491 Y:26240809-26240831 TGCCTACTAATAAATGTAGAAGG + Intergenic