ID: 1061387488

View in Genome Browser
Species Human (GRCh38)
Location 9:130299115-130299137
Sequence CTTCGTGGGCAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061387488_1061387498 10 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387498 9:130299148-130299170 ATGGCTCCACCCATCAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 148
1061387488_1061387503 16 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387503 9:130299154-130299176 CCACCCATCAGCTGTGGGGCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
1061387488_1061387492 -9 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387492 9:130299129-130299151 CCCACGAAGCCCCTCTCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 159
1061387488_1061387499 11 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387499 9:130299149-130299171 TGGCTCCACCCATCAGCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 184
1061387488_1061387500 12 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387500 9:130299150-130299172 GGCTCCACCCATCAGCTGTGGGG 0: 1
1: 1
2: 1
3: 12
4: 202
1061387488_1061387501 15 Left 1061387488 9:130299115-130299137 CCCTCCTGACTCTGCCCACGAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1061387501 9:130299153-130299175 TCCACCCATCAGCTGTGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061387488 Original CRISPR CTTCGTGGGCAGAGTCAGGA GGG (reversed) Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
901632416 1:10654373-10654395 CTTCGTGGGCAGAAGCGGGGAGG - Intronic
901656643 1:10773359-10773381 AGACGTGGGCAGAGACAGGAAGG + Intronic
902340571 1:15780964-15780986 CTTCCTGGCCAGGCTCAGGAAGG - Intronic
902381004 1:16052175-16052197 CTGCAAGGGCAGAGTCAGGCAGG - Intronic
902907185 1:19566917-19566939 AGCGGTGGGCAGAGTCAGGAAGG + Intergenic
904312309 1:29636779-29636801 CTCCATGGACAGAGTCATGAAGG + Intergenic
904326683 1:29731131-29731153 CTTCCCTGGCAGAGACAGGAGGG + Intergenic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
905873357 1:41417212-41417234 CTTCCTGGGGTGAGTCAGGGAGG + Intergenic
907010157 1:50955358-50955380 CTTGCTGGCCAGAGCCAGGAGGG - Intronic
908248696 1:62248102-62248124 CTTCCTGGGGAAAGTCAGGCTGG - Intronic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
914886756 1:151591482-151591504 CATCCTGGGCCGCGTCAGGATGG + Intergenic
915593456 1:156883427-156883449 CTCTGTGGGTAGAGACAGGAGGG + Intergenic
920609766 1:207424865-207424887 CTTCGATGGCAGAGTCAGATGGG - Intergenic
923575786 1:235157870-235157892 CTTCAGTGGCACAGTCAGGACGG + Intronic
1062885174 10:1010886-1010908 TGTAGGGGGCAGAGTCAGGATGG - Intronic
1063472605 10:6300251-6300273 CCTTGTGGGCAAAGGCAGGAAGG - Intergenic
1063898728 10:10709895-10709917 CTTCGTGGGGAGAGTTAGGTTGG - Intergenic
1064284960 10:13984095-13984117 CACCGTGGTCAGACTCAGGAAGG - Intronic
1065721004 10:28628837-28628859 CTTCTTTTGCAGAGTCAGGGAGG + Intergenic
1066394490 10:35005630-35005652 CTAGGTGGGCTGAGGCAGGAGGG + Intergenic
1067656492 10:48196062-48196084 CTTGGTGGTCTGAGCCAGGAAGG + Intronic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070819243 10:79345413-79345435 CTTCGTGGTGAGAGTGAGAAGGG + Intergenic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074111685 10:110427168-110427190 CCTCGGGGGTAGAGGCAGGAAGG + Intergenic
1075663596 10:124215247-124215269 CTTCTTGGCCAGAATCATGATGG - Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1077225596 11:1437865-1437887 CTTCCTGGGCAGTGTGGGGAGGG + Intronic
1077473809 11:2777095-2777117 CATCATGGGGAGAGCCAGGAGGG - Intronic
1077647828 11:3941925-3941947 TTTCGGAGGCAGAGGCAGGAGGG - Intronic
1081729140 11:45356255-45356277 CCTAGTGAGCAGAGCCAGGAAGG + Intergenic
1083171401 11:60925597-60925619 CTTGGTGGGGAGGGCCAGGAAGG + Intronic
1083590710 11:63892318-63892340 CTACGTGGGCACAGTGAAGAAGG + Intronic
1083678598 11:64341197-64341219 GTGCGGGGGCAGAGGCAGGAGGG - Intronic
1084418875 11:69050210-69050232 CTTCCTGGGACCAGTCAGGAAGG + Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085270011 11:75264708-75264730 CTTGGTGGCCAGAGCTAGGAAGG + Exonic
1086912701 11:92491430-92491452 CCTTGTGGGAAGAATCAGGAAGG + Intronic
1086981920 11:93207492-93207514 CTTCCTGGCCAGTCTCAGGAGGG + Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1092770173 12:11889589-11889611 ACTCGTGAGAAGAGTCAGGAGGG + Intronic
1095899851 12:47316977-47316999 CTTCCTGGGAAAGGTCAGGATGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096818629 12:54217223-54217245 CATTGTGGGAAGAGTCAGCAAGG + Intergenic
1100546682 12:95609608-95609630 CTTGGTAGGCTGAGACAGGAGGG + Intergenic
1101933169 12:109032194-109032216 CTTGGGAGGCTGAGTCAGGAGGG + Intronic
1102236860 12:111299015-111299037 TCTGGTGGGCAGAGTCAGGCAGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102713944 12:114953331-114953353 CTTAGTGTGCAGAGGCAGGGAGG + Intergenic
1105279590 13:18955624-18955646 CTTGTTGGGCACACTCAGGATGG + Intergenic
1107468148 13:40667138-40667160 CATCGTGGGTGGAGCCAGGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1110591948 13:77273535-77273557 CTTCTTGGGGAGAAACAGGAAGG - Exonic
1114405262 14:22450428-22450450 CTCCCTGAGCAGAGTCAGAATGG + Intergenic
1117497237 14:56317924-56317946 CTTAAAGGGCAGAGCCAGGATGG + Intergenic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1119749711 14:77068467-77068489 CTTCGGGAGCAGTGGCAGGAGGG - Intergenic
1120013553 14:79444718-79444740 CTTGGGTGGCTGAGTCAGGAGGG + Intronic
1122309467 14:100785395-100785417 ACTGCTGGGCAGAGTCAGGAAGG - Intergenic
1125523393 15:40360461-40360483 AATGGTGGGCACAGTCAGGAAGG + Intronic
1127473943 15:59314680-59314702 CTTGGTGGTCAGACTGAGGAGGG + Intronic
1130716683 15:86341514-86341536 CTTAGTGGGAGGACTCAGGAAGG + Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1132036218 15:98487048-98487070 CTTCTGAGGCAGAGTCAGCAGGG - Intronic
1132627330 16:897713-897735 CTCCGTGGGCAGAGGCACTATGG + Intronic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1132938688 16:2496172-2496194 CTTCGTGGACAAAGACAAGATGG + Exonic
1133018732 16:2956579-2956601 CAGCGTGGGCAGAGCCAGGGAGG - Intergenic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133816252 16:9199533-9199555 CTCCTGGGGCAGAGGCAGGAAGG - Intergenic
1137698428 16:50478488-50478510 GTTCATGGGCAGAGACAGGGTGG + Intergenic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1142521224 17:506152-506174 CTTCGAGAGCAGGGTCAGGACGG + Intergenic
1142521306 17:506802-506824 CTTCGAGAGCAGGGTCAGGACGG + Intergenic
1144308749 17:13993077-13993099 CTTCCGGGGCAGAGTAAAGAAGG + Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1148741976 17:49898182-49898204 ATTCTTGGGAAGAGTAAGGAGGG - Intergenic
1149769185 17:59306605-59306627 CTTAGGAGGCAGAGACAGGAGGG + Intergenic
1150287435 17:63962072-63962094 CTTTGTGGGGTGAGTCAAGAGGG - Intronic
1150704798 17:67477181-67477203 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1152409069 17:80112853-80112875 CTGGGAGGGCAGAGTCAGGCTGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1155181396 18:23351297-23351319 CTTGGGAGGCTGAGTCAGGAGGG + Intronic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155996086 18:32332824-32332846 CTTCTGGGGCACAGACAGGAGGG - Intronic
1156338385 18:36188797-36188819 CTAAGTAGGGAGAGTCAGGAGGG + Intronic
1156356456 18:36346256-36346278 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
1158882108 18:61790036-61790058 CCTCCTGGGCAGAGTCAGATTGG + Intergenic
1160305922 18:77736512-77736534 CCTTGTGCTCAGAGTCAGGAGGG + Intergenic
1160562427 18:79766971-79766993 CCTGGTGGGCAGAGCAAGGATGG - Intergenic
1160837017 19:1129605-1129627 CTGGGTGGGCAGTGTCCGGAGGG - Intronic
1163187542 19:15649598-15649620 CTTTGTGGACAGCTTCAGGAAGG + Intronic
1167335866 19:48885443-48885465 TTTCGTGGGCAAAGTCAGGTGGG - Exonic
924985135 2:264008-264030 CTTCCTGGGCAGCCTCGGGACGG - Exonic
928123153 2:28598518-28598540 CTTCCTGGGGAGAGGCAGGGAGG - Intronic
929499659 2:42479536-42479558 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
932577387 2:72970265-72970287 CTTCATGGTCAGCCTCAGGAAGG + Intronic
933644503 2:84799425-84799447 CTACTTGGGCAGAGACTGGAGGG + Intronic
935049404 2:99511496-99511518 CTTCGGAGGCTGAGGCAGGAGGG + Intergenic
935050048 2:99517720-99517742 CTTCGTGGGCTGTGTTAGGGAGG + Intergenic
935234655 2:101128368-101128390 CTTCCTGGGAAGAGTAATGAGGG + Intronic
935460007 2:103319064-103319086 CTTCCTTGGCTCAGTCAGGAAGG + Intergenic
937428893 2:121821828-121821850 CTTCGCTGGTAGAGGCAGGATGG - Intergenic
939496525 2:142933512-142933534 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
945332436 2:208555562-208555584 TTTCGTGGACAGAGAGAGGATGG - Intronic
946402827 2:219477501-219477523 CTTCCTGGGCAGAGCATGGAGGG - Intronic
947535032 2:230934862-230934884 CTTGGTGGGTGGAGTCAGGGTGG - Intronic
947873902 2:233455664-233455686 CTTCGTCCGCTGAGTCAGGATGG + Intronic
948909195 2:240994520-240994542 CTTCCTGGCCAGAGGCTGGATGG - Intergenic
1169806699 20:9567077-9567099 CTTCCTGGAAAGAATCAGGAAGG + Intronic
1169935633 20:10880551-10880573 CTTCGTGGGAAAGGGCAGGAAGG - Intergenic
1172243872 20:33432285-33432307 CTTCCTGGGAAGAGCCAGTAGGG + Intronic
1172285701 20:33738873-33738895 CTGCGCTGGCAGCGTCAGGAGGG + Intronic
1172337080 20:34125858-34125880 CTTAGGAGGCTGAGTCAGGAGGG + Intergenic
1172707472 20:36892546-36892568 CTTGGGGGGCTGAGGCAGGAGGG + Exonic
1173905840 20:46628133-46628155 CTTCAAGGGCAGATTCAGGTAGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1177073533 21:16542930-16542952 CTTTGTGGGATGAGGCAGGAAGG + Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1178827397 21:36028337-36028359 CTCTGTGGGCAGAGCCAGGATGG + Intergenic
1178909857 21:36665826-36665848 CTTGGAGGGCTGAGGCAGGAGGG - Intergenic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180217758 21:46336724-46336746 CTCCGTGGACAGAGTGAGGAAGG + Intronic
1183083942 22:35475050-35475072 GGACGTGGGCAGAGTCAAGAAGG + Intergenic
1184255631 22:43285338-43285360 GGGCGTGGGCAGAGCCAGGATGG - Intronic
1184357949 22:43995275-43995297 CTTCTTGCTCAGAGTCAGGTTGG + Intronic
950108176 3:10401502-10401524 CTTTTAGGGCAGAGTGAGGAGGG + Intronic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
951407856 3:22323256-22323278 GTCTGTGGGCAGGGTCAGGAAGG - Intronic
952376614 3:32772971-32772993 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
952990806 3:38829325-38829347 CTTAGGGGCCAGAGTCAGGCAGG - Intergenic
957132413 3:76239646-76239668 CTTCTTGGGAAGAGCCATGATGG + Intronic
961237646 3:125381303-125381325 CTTGGTGGGCTGAGGTAGGAGGG + Intergenic
965486424 3:169284131-169284153 CTCCTTGGGCAGAGTCTTGATGG - Intronic
965789461 3:172372281-172372303 CTTCATGGGCACAGGCAGCAGGG + Intronic
966869350 3:184279957-184279979 CTCCGTGCTCTGAGTCAGGAAGG + Intronic
968628815 4:1639662-1639684 CTTGCAGGGCAGAGGCAGGAGGG + Intronic
971689449 4:29814245-29814267 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977515482 4:98016915-98016937 CTTGGTGGGCTGAGTAATGATGG - Intronic
981055015 4:140351466-140351488 TTTAGAGAGCAGAGTCAGGACGG - Intronic
981781804 4:148439525-148439547 CTTCCTGGTCATAGTCAAGAGGG + Intronic
990878709 5:60517195-60517217 CTTGGTGCACAGAGTCTGGAGGG - Intronic
997537690 5:134635312-134635334 CTTGGTTGGGAGAGTCAGGCAGG - Intronic
998298183 5:140992218-140992240 CTTCCTGGGAAGAGTAAGGAAGG + Intronic
999305684 5:150518044-150518066 TGTCCTGGGCAGAGCCAGGAAGG - Intronic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000362488 5:160460978-160461000 TCTCGTGGGCTGAGGCAGGAGGG - Intergenic
1001776274 5:174331387-174331409 CTTGGGAGGCTGAGTCAGGAGGG + Intergenic
1002588220 5:180266693-180266715 CTACTTGGGCTGAGGCAGGAGGG - Intronic
1002911399 6:1493817-1493839 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1007001899 6:38321286-38321308 CTTCTTGGGGAAAGGCAGGAGGG + Intronic
1007359570 6:41345465-41345487 CTTCTTGGCAAGAGTGAGGAGGG + Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1011450221 6:87484029-87484051 CTTGGTGGTCAAAGTCTGGAGGG - Intronic
1014558633 6:122863686-122863708 CTTCCAGGGCAAAGTGAGGAAGG + Intergenic
1015970573 6:138739298-138739320 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1017333717 6:153229679-153229701 CATGGTGGGCTGAGTCAGGAAGG + Intergenic
1017865357 6:158438476-158438498 CTTTGTCGGCATAGTCAGAAAGG + Intronic
1018493846 6:164327246-164327268 CCTTGTGAGCAGAGTCACGATGG + Intergenic
1018508163 6:164493937-164493959 CTTCGTGAGCAGAACCAGGGTGG - Intergenic
1019127237 6:169848932-169848954 CTTCTTGGGCAGAATGAGGCTGG + Intergenic
1019159032 6:170057352-170057374 CTGCGAGGGCAGTGCCAGGAGGG + Intergenic
1020462059 7:8437167-8437189 CTTCGGTGACAGAGTCAGAAAGG - Intronic
1023373563 7:39534593-39534615 CTTCAAGGTCAGATTCAGGATGG - Intergenic
1024605948 7:51022702-51022724 CATCTTGTGCAGAGTCATGAAGG - Intronic
1026151480 7:67791324-67791346 CTTTGTGGGTAGAGCCAGGCTGG + Intergenic
1028583786 7:92433693-92433715 CTTTGAGGGCAGAGACAGCAAGG - Intergenic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1029535911 7:101157555-101157577 CTTCCAGGGCAGAGACTGGAGGG - Intronic
1034456375 7:151173216-151173238 CTTAGCGGGCAATGTCAGGAGGG - Intronic
1038856885 8:31343790-31343812 CTTCATGGACACAGGCAGGATGG + Intergenic
1041259206 8:56005500-56005522 CTTCCTGGGCTGAGTTGGGATGG + Intronic
1041966591 8:63685581-63685603 CTTCGTGGCCAGAGGCAGGGTGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1048141732 8:131801537-131801559 CTTTGTGGGCTAAGTGAGGATGG - Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1052834705 9:33241721-33241743 CTGCCTGGGCTGAGTGAGGAGGG + Intronic
1053579735 9:39392073-39392095 AGTCGTGGGCAGAGGCAGGAAGG - Intergenic
1053844250 9:42220150-42220172 AGTCGTGGGCAGAGGCAGGAAGG - Intergenic
1054101322 9:60950882-60950904 AGTCGTGGGCAGAGGCAGGAAGG - Intergenic
1054122695 9:61226245-61226267 AGTCGTGGGCAGAGGCAGGAAGG - Intergenic
1054585029 9:66955999-66956021 AGTCGTGGGCAGAGGCAGGAAGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056456663 9:86766979-86767001 TTTCGTGGGCAGAGCCAAAAGGG - Intergenic
1056934395 9:90904791-90904813 CATCGTGGGCACAGACTGGAGGG - Intergenic
1058681281 9:107442391-107442413 CTTCGAGGGATGAGTTAGGAAGG + Intergenic
1058954531 9:109933174-109933196 CTTCCTGGACAGTGACAGGATGG + Intronic
1059347522 9:113639712-113639734 CTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1059457787 9:114410674-114410696 CTTCAGGGGCATAGTCAGGCAGG + Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060724438 9:125997735-125997757 CCTCTTGGGCAGAGTCTGGGAGG - Intergenic
1061360612 9:130139654-130139676 CGTTCTGGGCAGAGTCAGAATGG + Exonic
1061387488 9:130299115-130299137 CTTCGTGGGCAGAGTCAGGAGGG - Intronic
1061392713 9:130326785-130326807 CTTCGTCGGCAGAAACAGCATGG - Intronic
1190853153 X:54266300-54266322 GGTAGTGGGGAGAGTCAGGAGGG + Intronic
1191890242 X:65932170-65932192 CTTGGTGGTCAGACTCTGGAGGG - Intergenic
1192282349 X:69699965-69699987 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
1193395185 X:80975498-80975520 ATTTGTGACCAGAGTCAGGATGG + Intergenic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1199278250 X:145971128-145971150 CTTGGTGGTCAGATTCTGGAGGG + Intergenic
1201900261 Y:19041335-19041357 CTTGGTGGTCAGATTCTGGAGGG - Intergenic