ID: 1061387947

View in Genome Browser
Species Human (GRCh38)
Location 9:130301485-130301507
Sequence CTCTGGGTTTGGAGAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061387939_1061387947 17 Left 1061387939 9:130301445-130301467 CCAGGTCTGGGAGGCTGGAATTT 0: 1
1: 0
2: 2
3: 22
4: 189
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387935_1061387947 24 Left 1061387935 9:130301438-130301460 CCGCCCTCCAGGTCTGGGAGGCT 0: 1
1: 0
2: 5
3: 298
4: 6049
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387937_1061387947 21 Left 1061387937 9:130301441-130301463 CCCTCCAGGTCTGGGAGGCTGGA 0: 1
1: 0
2: 3
3: 35
4: 531
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387938_1061387947 20 Left 1061387938 9:130301442-130301464 CCTCCAGGTCTGGGAGGCTGGAA 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387944_1061387947 -8 Left 1061387944 9:130301470-130301492 CCTTGTAGCAGGTGGCTCTGGGT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387932_1061387947 26 Left 1061387932 9:130301436-130301458 CCCCGCCCTCCAGGTCTGGGAGG 0: 1
1: 0
2: 0
3: 38
4: 391
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387929_1061387947 30 Left 1061387929 9:130301432-130301454 CCTTCCCCGCCCTCCAGGTCTGG 0: 1
1: 0
2: 4
3: 53
4: 552
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data
1061387934_1061387947 25 Left 1061387934 9:130301437-130301459 CCCGCCCTCCAGGTCTGGGAGGC 0: 1
1: 1
2: 3
3: 34
4: 414
Right 1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061387947 Original CRISPR CTCTGGGTTTGGAGAGATGA GGG Intronic
No off target data available for this crispr