ID: 1061390313

View in Genome Browser
Species Human (GRCh38)
Location 9:130314134-130314156
Sequence CAACCAGGAGCTTCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061390313_1061390323 -5 Left 1061390313 9:130314134-130314156 CCCATCCTGGAAGCTCCTGGTTG 0: 1
1: 0
2: 1
3: 8
4: 211
Right 1061390323 9:130314152-130314174 GGTTGCCGGGGGCCGAGCTGGGG No data
1061390313_1061390327 17 Left 1061390313 9:130314134-130314156 CCCATCCTGGAAGCTCCTGGTTG 0: 1
1: 0
2: 1
3: 8
4: 211
Right 1061390327 9:130314174-130314196 GAACAGGAGATGTGCTGTTTTGG No data
1061390313_1061390322 -6 Left 1061390313 9:130314134-130314156 CCCATCCTGGAAGCTCCTGGTTG 0: 1
1: 0
2: 1
3: 8
4: 211
Right 1061390322 9:130314151-130314173 TGGTTGCCGGGGGCCGAGCTGGG No data
1061390313_1061390325 1 Left 1061390313 9:130314134-130314156 CCCATCCTGGAAGCTCCTGGTTG 0: 1
1: 0
2: 1
3: 8
4: 211
Right 1061390325 9:130314158-130314180 CGGGGGCCGAGCTGGGGAACAGG No data
1061390313_1061390321 -7 Left 1061390313 9:130314134-130314156 CCCATCCTGGAAGCTCCTGGTTG 0: 1
1: 0
2: 1
3: 8
4: 211
Right 1061390321 9:130314150-130314172 CTGGTTGCCGGGGGCCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061390313 Original CRISPR CAACCAGGAGCTTCCAGGAT GGG (reversed) Intronic
900155958 1:1203363-1203385 CAGCCAGGAGTTCCCAGAATGGG + Intergenic
900605459 1:3521701-3521723 CTCCCGGGAGTTTCCAGGATAGG - Intronic
900803175 1:4750323-4750345 CAGCCAGGCTCTTCCAGCATTGG - Intronic
901533798 1:9869884-9869906 CACCCAAGAGATCCCAGGATGGG + Intronic
902893393 1:19461395-19461417 CAGCCAGGAGCTCCAAGGAGTGG - Intronic
905034235 1:34906870-34906892 ACTCCAGGAGCTGCCAGGATAGG + Intronic
905328885 1:37178066-37178088 AATCCAGAAGCTTCCAAGATGGG + Intergenic
910174996 1:84420036-84420058 CAAGACTGAGCTTCCAGGATTGG + Intergenic
911024562 1:93423299-93423321 CAACAAGGAGCTGGCAGGTTTGG - Intergenic
913329867 1:117658573-117658595 CATCCAGCAGGTTCCAGGAAGGG + Intergenic
913586126 1:120277487-120277509 CCCCCAAGAGCTTCCAGGAAAGG - Intergenic
913622060 1:120620882-120620904 CCCCCAAGAGCTTCCAGGAAAGG + Intergenic
914568135 1:148889345-148889367 CCCCCAAGAGCTTCCAGGAAAGG - Intronic
914604689 1:149240904-149240926 CCCCCAAGAGCTTCCAGGAAAGG + Intergenic
916479482 1:165202196-165202218 CATCCAGGAGGGGCCAGGATAGG - Exonic
920423793 1:205857069-205857091 CATCTAGGAGCTTTCTGGATGGG - Intergenic
921111138 1:212038003-212038025 GTACCATGAGCTGCCAGGATAGG - Intronic
923605133 1:235436563-235436585 CTACCAGGTACTTCAAGGATGGG - Exonic
923651938 1:235882359-235882381 CACACAGGAGCTTTCAAGATCGG - Intronic
924496225 1:244592644-244592666 CAACCTGGAGCATCTAGGCTGGG - Intronic
1063067257 10:2622900-2622922 AACCCAGGAGTTACCAGGATTGG - Intergenic
1064392889 10:14956784-14956806 CAGGCAGGAGCCACCAGGATGGG - Intergenic
1072410364 10:95196245-95196267 CCAGCAGAAGCTTCCAGGCTGGG + Intronic
1073276946 10:102320081-102320103 CATCCAGTAGCTTCTAGGAAAGG + Intronic
1073306772 10:102509057-102509079 CACCCAGGTTCCTCCAGGATGGG + Intronic
1074246177 10:111695971-111695993 CAACCAGCAGTTTCCCAGATGGG + Intergenic
1074913903 10:117937809-117937831 CAACCAGAAACTTCCAGAAGAGG + Intergenic
1075378229 10:121996937-121996959 CAACCAGGAGCTTCAGGATTTGG - Intronic
1076055150 10:127366744-127366766 CATCCACGAGCTTCTGGGATGGG + Intronic
1076103478 10:127801591-127801613 CATCGAGAAGCTTCCATGATTGG - Intergenic
1076303537 10:129446819-129446841 CACCCAGGACCTTCCTGGCTAGG - Intergenic
1076432022 10:130410706-130410728 CCACCAGGAAGGTCCAGGATAGG + Intergenic
1077406170 11:2383448-2383470 CACCAAGGTGCTTCCAGGAAGGG - Intronic
1077496077 11:2886983-2887005 AAACCAGGAGCCTCCCAGATCGG + Intergenic
1078015543 11:7610501-7610523 CACCCAATAGCTTCCAGGCTGGG - Intronic
1078512917 11:11998869-11998891 GAAGCAGGAGCATCCAGTATAGG + Intronic
1080370866 11:31640981-31641003 CAACCAGAAGCTCCCAGAACAGG - Intronic
1083349757 11:62019125-62019147 TAAGCAGGAGCTTCCTGGAGGGG + Intergenic
1083365633 11:62140098-62140120 CACCCCGGAGCTGCCAGGAAGGG + Intronic
1083690373 11:64404702-64404724 CACCCGGGAGATTCCAGGACAGG - Intergenic
1084344846 11:68539927-68539949 CAACCAGGAACATCCAGGCAGGG + Intronic
1086440251 11:86822711-86822733 CAACCAGGACTGTCCAGGAATGG + Intronic
1087659044 11:100964238-100964260 CAACCAGGAACTGCCAAGTTGGG + Intronic
1088622547 11:111701072-111701094 GTACCAGGAGCTTCTAAGATGGG - Intronic
1089654997 11:119940891-119940913 CAGCCAGGAGGGCCCAGGATTGG + Intergenic
1091680834 12:2525385-2525407 TATCCTGGAGCCTCCAGGATAGG - Intronic
1092091063 12:5803968-5803990 CATCCAGGTGCTGGCAGGATGGG + Intronic
1093982877 12:25494049-25494071 AAACAAGGAGCCTCCTGGATAGG - Intronic
1097227809 12:57488880-57488902 CAACCCAGAAGTTCCAGGATAGG - Intronic
1100695241 12:97085550-97085572 TAACCAGGAACTTCAAGGAGAGG - Intergenic
1103924416 12:124415664-124415686 CAGGCAGGGGCTCCCAGGATGGG - Intronic
1104675182 12:130707607-130707629 CAATCAGAAGCTTCCAAGAGTGG + Intronic
1104719187 12:131035177-131035199 CGACCAGGAGCGACCAGGAAGGG - Intronic
1107427219 13:40306161-40306183 CAACCAGGAGCTTCAATGGGTGG + Intergenic
1109272277 13:60267973-60267995 CAGCCAGGAGTCTCCAGGAAAGG - Intergenic
1110780210 13:79456496-79456518 AAACCAGGAGCTACAAAGATGGG + Intergenic
1114819020 14:25993793-25993815 CAACCAGTGGCTTACAGGTTAGG - Intergenic
1115144863 14:30214873-30214895 AAACCAGGTGCCTCCAGGGTAGG - Intergenic
1115468012 14:33737395-33737417 CAACCTTGAACATCCAGGATTGG + Intronic
1117543344 14:56769939-56769961 CCACCAGGATCTTCATGGATTGG + Intergenic
1117973810 14:61279337-61279359 CAACCATGATGTTCCAGGTTTGG - Exonic
1119548732 14:75492840-75492862 CAGCCAGGAGGTGCCAGGCTGGG - Intergenic
1122171066 14:99876204-99876226 CAGGCAGGAGCTGCCTGGATGGG + Intronic
1122354307 14:101113989-101114011 CTGCCAGGAGCTGCCAGGAGAGG - Intergenic
1123473785 15:20572660-20572682 CCACCAGGAGCACCCAGGCTTGG + Intergenic
1123644223 15:22427693-22427715 CCACCAGGAGCACCCAGGCTTGG - Intergenic
1123665533 15:22607599-22607621 CCACCAGGAGCACCCAGGCTTGG - Intergenic
1123734086 15:23167671-23167693 CCACCAGGAGCACCCAGGCTTGG + Intergenic
1123752223 15:23365053-23365075 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124284589 15:28388982-28389004 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124298108 15:28522632-28522654 CCACCAGGAGCACCCAGGCTTGG - Exonic
1124319364 15:28702013-28702035 CCACCAGGAGCACCCAGGCTTGG - Exonic
1124483155 15:30093418-30093440 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124489604 15:30145486-30145508 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124520424 15:30403799-30403821 CCACCAGGAGCACCCAGGCTTGG - Exonic
1124538233 15:30562420-30562442 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124544696 15:30614480-30614502 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124760420 15:32445165-32445187 CCACCAGGAGCACCCAGGCTTGG - Exonic
1124778216 15:32603897-32603919 CCACCAGGAGCACCCAGGCTTGG + Exonic
1124958992 15:34381470-34381492 CCACCAGGAGCACCCAGGCTTGG - Exonic
1124975619 15:34527691-34527713 CCACCAGGAGCACCCAGGCTTGG - Exonic
1128556730 15:68636723-68636745 CACCCAGGAACTTCCAGGTGTGG + Intronic
1129230833 15:74196397-74196419 CTTCCTGGAGCTTCCAGGGTGGG - Intronic
1129463318 15:75710700-75710722 CAGCCAGGGGCATCCAGGAGGGG + Intronic
1129713946 15:77836215-77836237 CATCCTGAAGCTGCCAGGATGGG + Intergenic
1130044056 15:80430456-80430478 ATCCAAGGAGCTTCCAGGATAGG - Intronic
1132807404 16:1781543-1781565 CAGCCCTGAGCTTCCAGGCTGGG + Intronic
1136527044 16:30838014-30838036 GAACCAGGACATTCCAGGCTTGG + Intronic
1140730742 16:77853644-77853666 GAATCAGAAACTTCCAGGATGGG - Intronic
1140745113 16:77974329-77974351 AAGCCATAAGCTTCCAGGATGGG - Intronic
1141518850 16:84564198-84564220 CGACCAGGAGATTCCAGGAGAGG + Intergenic
1141625450 16:85259001-85259023 CCCCCAGGAGCTGCCAGGCTGGG + Intergenic
1141839591 16:86566285-86566307 CAACAGGGAGTTTCCAGGCTCGG - Intergenic
1142118147 16:88371292-88371314 CAATTAGGAGAATCCAGGATGGG + Intergenic
1142887603 17:2922465-2922487 CCACCAGGAACTCCCAGGAGAGG - Intronic
1144876585 17:18400297-18400319 CAACCTGGCCCTTCCAGGCTGGG - Intergenic
1145155641 17:20544123-20544145 CAACCTGGCCCTTCCAGGCTGGG + Intergenic
1145289410 17:21531267-21531289 CAACCAGAAGCTCCCGGGATAGG + Exonic
1146016161 17:29235472-29235494 CGAACAGAAGCTTCCAGGCTAGG + Intergenic
1146268331 17:31467922-31467944 CAAACAGGAGCTGGCAGGCTGGG - Intronic
1148027561 17:44599288-44599310 CAACCAGAAGCTCCCAGAACAGG + Intergenic
1148723983 17:49775590-49775612 CCATCAGGGGCTTCCAGAATTGG - Intronic
1149337082 17:55646383-55646405 GAACCTGGGGCCTCCAGGATGGG - Intergenic
1151881416 17:76897435-76897457 CCACCAGGAGCAGCCAGGAAGGG - Intronic
1152279357 17:79376231-79376253 CAACCAGTCGATTCCAGGCTGGG - Intronic
1153059622 18:981933-981955 CAACAAGCAGCTTTCAGGAGTGG - Intergenic
1154110055 18:11559976-11559998 CAGCCAGGAGCTGGCAGGGTCGG + Intergenic
1157532793 18:48436112-48436134 CCTCAAGGAGCTTCCAGGAAAGG - Intergenic
1159103497 18:63980588-63980610 CACCCAGCAGCTACCAGGACAGG - Intronic
1159932144 18:74323991-74324013 GCACCTGGAGCTGCCAGGATAGG + Intronic
1160156261 18:76436177-76436199 TAAACAGGAGCTTGCAGAATGGG - Intronic
1160446691 18:78933722-78933744 AAACCAGAAACTTCCAGAATAGG - Intergenic
1160673235 19:376157-376179 CACTCAGGACCTCCCAGGATTGG + Intergenic
1162275578 19:9651545-9651567 AAACCAGCAGCCTCCAGCATGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1162440929 19:10691684-10691706 CCACCAGGAGCATCCATGAGCGG + Exonic
1163289485 19:16370149-16370171 CCACCAGGAGCTCCCATGGTGGG + Intronic
1163714755 19:18867306-18867328 GAACGAGCAGCTTCCAGGCTCGG - Exonic
1163721166 19:18898901-18898923 CAAAAAGGAGCTGCCAGGCTAGG - Intergenic
1167815902 19:51880819-51880841 GAAGAAGGAGCTTCCAGGCTGGG - Exonic
1168207953 19:54866134-54866156 CATCCAGAAGCTTCCATGACAGG + Intronic
926615718 2:14994926-14994948 CAGCCATGGGCTTCAAGGATGGG - Intergenic
927041533 2:19235641-19235663 CTTTCAGGAGCTTCCAGGGTAGG + Intergenic
929115627 2:38441557-38441579 CAGCCAAGACCTTCCACGATTGG - Intergenic
929613965 2:43293590-43293612 CAACCAAGAGCTTCTGGGAAAGG - Intronic
931239969 2:60443524-60443546 CAACCAGTGCCTTCCAGGATCGG + Intergenic
931482727 2:62658166-62658188 CAAGCAGGAACTTCCTGGCTAGG + Intergenic
934946947 2:98549253-98549275 CACCCAGGGGCTTCCTGGGTCGG - Intronic
935373329 2:102370156-102370178 CATCCAGGAGCTCCAAGGCTAGG - Intronic
937831977 2:126434181-126434203 AATCCACGAGCTTCCAGGAAGGG - Intergenic
938685520 2:133734090-133734112 AAACCAGGAAATTCCAGGGTGGG + Intergenic
940970468 2:159891474-159891496 AATCCAGAAGCTTCCAGGAGTGG + Intronic
941101355 2:161299182-161299204 CAAATATGAGTTTCCAGGATTGG + Intergenic
944908731 2:204288312-204288334 TATCCTGGAGCTACCAGGATGGG + Intergenic
949079364 2:242084592-242084614 CTTCCAGCACCTTCCAGGATTGG + Intergenic
1171084132 20:22220394-22220416 TAACCTGGAACTTCCTGGATGGG - Intergenic
1171084134 20:22220396-22220418 CATCCAGGAAGTTCCAGGTTAGG + Intergenic
1173433158 20:43009470-43009492 CAAAAAGGAGGTTCCAGGAAAGG + Intronic
1174101604 20:48130636-48130658 CTACCAGGAGCTTCCACGATAGG - Intergenic
1175303696 20:57961256-57961278 CACCCAGGGACTTCCAGGTTGGG + Intergenic
1177507845 21:22040853-22040875 CAAGCAGGTGCTGCCAGGCTCGG + Intergenic
1178339915 21:31777613-31777635 CTTCCAGGAGGTTCCAGGAGAGG + Intergenic
1178593462 21:33931703-33931725 CAACCAGGTGCCTCCAAAATGGG - Intergenic
1179666883 21:42919003-42919025 TAACCACGTGCTTCCAGGAATGG - Intergenic
1179789136 21:43745914-43745936 CAACCTCGATCTTCCAGGCTCGG - Intronic
1179891563 21:44338385-44338407 AGACCAGGAGCTTCCAGAAGAGG - Intronic
1179952698 21:44719033-44719055 CCACCTGGAGCTTCCAGTCTGGG - Intergenic
1182298038 22:29321403-29321425 AAACCAGGAGCAGCCAGGCTGGG - Intergenic
949451714 3:4192705-4192727 CAACCAGGAGATTAAAGGGTTGG + Intronic
950488148 3:13285011-13285033 CTTTCAGGAGCTTCCAGGCTTGG + Intergenic
952520270 3:34149978-34150000 CATCCAGGAGAGACCAGGATGGG - Intergenic
956508486 3:69968763-69968785 CAACCAGGAGCTGGCAGCCTGGG - Intergenic
958080749 3:88743477-88743499 CAACCAGGAGCATCCACATTGGG - Intergenic
960610018 3:119547120-119547142 CAACCAGGAGCCTCTAGGCAAGG - Intronic
961551180 3:127671456-127671478 CAACCAGCAGCTGCCAGGCGCGG + Exonic
961651597 3:128419535-128419557 CCACCAGGAGCTGCCAGCAAGGG + Intergenic
962282346 3:134061428-134061450 CAAGCAGGAGCTTTCTGGAAGGG - Intergenic
962347586 3:134629723-134629745 CAACCAGATGCTGCCAGGAAAGG + Intronic
962747583 3:138408764-138408786 CACCCAGGAGCTTTCTGGAAAGG + Intergenic
964637975 3:158878186-158878208 CAATCAGGAGTCTCCAGGAGTGG - Intergenic
965403289 3:168239506-168239528 CCTCCAGTAGCTTCCAGGAAAGG + Intergenic
967031170 3:185608534-185608556 TATCCACGAGCTTCCAGGAGAGG - Intronic
967166424 3:186783770-186783792 CTTCCAGAAGCTTCCATGATGGG + Intronic
968553495 4:1236183-1236205 CCCCCAGGAGCTCACAGGATAGG - Intronic
968795043 4:2697827-2697849 CATTCAGGAGCGTCCAGCATCGG + Intronic
968878435 4:3286373-3286395 CAGCCAGGAGCTTTCAGGGCCGG - Intergenic
969432223 4:7161996-7162018 CAACCAGGAACAGCCAGGAGAGG - Intergenic
970477194 4:16435600-16435622 GAACCAGGAGCTCCAAGGATAGG + Intergenic
983325814 4:166255619-166255641 AAATCAAGAGCCTCCAGGATAGG - Intergenic
986223798 5:5794315-5794337 CGTCAAGGAGCTGCCAGGATAGG - Intergenic
988306368 5:29499133-29499155 CAAGCAGGAACTACCAGGCTGGG + Intergenic
996746177 5:126848054-126848076 CAACCAGCAGATGCCAGGAAGGG + Intergenic
999259537 5:150229404-150229426 CACCCAGGTGCCTCCAGGGTTGG - Intronic
999763953 5:154724054-154724076 CAACCATGATCTTCCAGGAGTGG + Intronic
1000152664 5:158518727-158518749 CACCCAGTAACTTCCAGTATAGG + Intergenic
1000195345 5:158951809-158951831 CAATGAGGAGCTTTCAGGCTTGG + Intronic
1000293175 5:159890169-159890191 GAACCAAGAGCTTCCTGGACAGG - Intergenic
1001513319 5:172338486-172338508 ACACCAGCAGCTTCCAGGAAGGG - Exonic
1001600465 5:172924900-172924922 CCACCTGGAGCTTCCAGTCTAGG + Intronic
1001998045 5:176177763-176177785 CCACCTGCTGCTTCCAGGATGGG - Intergenic
1002805361 6:568419-568441 CAAACTGGAGCTTACAGCATCGG + Intronic
1002988040 6:2210556-2210578 CAGCTAGGGGCTTCCAGGAAAGG + Intronic
1009919459 6:70039363-70039385 CTTTCAGGAGCTTCCAGGAGAGG + Intronic
1011307541 6:85945122-85945144 CAACCATGAGCAACCAGAATAGG - Intergenic
1016760484 6:147730770-147730792 CAACCAGGAGTTTTAAGGAAGGG + Intronic
1019433630 7:1010949-1010971 CCACCGGGAGCTTCCAGGAAGGG + Intronic
1019989799 7:4683071-4683093 CAGGCTGGAGCCTCCAGGATCGG - Intronic
1020516677 7:9130241-9130263 CACCCTGCAGCTTCCAGAATGGG - Intergenic
1024244717 7:47460519-47460541 CAACCTTCAGCTCCCAGGATGGG + Intronic
1027601032 7:80241382-80241404 CTACCAGGAGTTTCCAGTTTGGG - Intergenic
1027684356 7:81264253-81264275 CAACCATGAGCTCCCATGAGTGG + Intergenic
1030608083 7:111660032-111660054 CAAAAGGGAGCTTCCAGGCTGGG + Intergenic
1030896110 7:115062084-115062106 CAGCCAGGATCTCCCAAGATTGG - Intergenic
1033144204 7:138857017-138857039 AAACCAGGTGCTTCAAGGATGGG - Intronic
1034243231 7:149625040-149625062 CAAGCAGGGGCTTCCAGGCAGGG + Intergenic
1035537512 8:403680-403702 CTTCCAGCACCTTCCAGGATTGG + Intergenic
1038141280 8:24848076-24848098 CAACCAGCAGCCTCAAGGGTGGG + Intergenic
1040303558 8:46200580-46200602 CACCTGGGAGCTTCTAGGATGGG - Intergenic
1045520708 8:102900650-102900672 CAGCCAGCAGCTTCAAAGATTGG + Intronic
1048612042 8:136033574-136033596 CAAGCAGGTGGTTCCAGGACAGG - Intergenic
1048779951 8:137989780-137989802 CAATCAGGAGTCTCCAGGAAAGG + Intergenic
1048818256 8:138354480-138354502 CACCCAGGAGGTATCAGGATGGG - Intronic
1048919697 8:139217047-139217069 CATCCAGGGGCTTGCAGGCTCGG - Intergenic
1049412205 8:142478399-142478421 CAAGCAGGAGCCTCTAGGAAGGG + Intronic
1053524216 9:38812340-38812362 AATCCAGGAGCCTCCAGAATAGG + Intergenic
1054196449 9:62036750-62036772 AATCCAGGAGCCTCCAGAATAGG + Intergenic
1054641957 9:67551937-67551959 AATCCAGGAGCCTCCAGAATAGG - Intergenic
1054922642 9:70557562-70557584 TAAGCAGCAGATTCCAGGATGGG + Intronic
1055641853 9:78324892-78324914 CACCGAGGAGCTTCAAGCATGGG - Intronic
1056779338 9:89537870-89537892 TAACCAGGAGCTGCCAGTTTGGG + Intergenic
1057279515 9:93699780-93699802 CAACCAGCAGCTGACAGGAGTGG - Intergenic
1058768357 9:108205700-108205722 AGACCAGGAGCATCCAGCATGGG + Intergenic
1059557919 9:115299970-115299992 CAACCAGGAACTTCTGGGCTTGG + Intronic
1061390313 9:130314134-130314156 CAACCAGGAGCTTCCAGGATGGG - Intronic
1062461587 9:136664685-136664707 CAACCAGCAGCCCCCAGGACCGG + Exonic
1062480506 9:136748736-136748758 CCACCAGAAGGTTCCAGAATGGG + Intergenic
1187040707 X:15592825-15592847 TAACCAGGAGATTCAAGAATGGG + Intronic
1192815423 X:74585719-74585741 CAACCAGGAGTCTGCTGGATAGG + Exonic
1196468128 X:115993563-115993585 CAAGCAGGTGCTGCCAGGCTTGG - Intergenic
1199579102 X:149343833-149343855 CAACCAGGAGCTCCGAAGTTAGG - Intergenic
1201982076 Y:19918788-19918810 CAGCCAGGAGGTTCCAGGAAAGG - Intergenic