ID: 1061395422

View in Genome Browser
Species Human (GRCh38)
Location 9:130341136-130341158
Sequence TCGGGTTCTGAAGGTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061395412_1061395422 -1 Left 1061395412 9:130341114-130341136 CCCCTCAGGTGCAGCCAGGCCCT 0: 1
1: 0
2: 3
3: 30
4: 238
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395407_1061395422 9 Left 1061395407 9:130341104-130341126 CCCTCAGTCCCCCCTCAGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395410_1061395422 1 Left 1061395410 9:130341112-130341134 CCCCCCTCAGGTGCAGCCAGGCC 0: 1
1: 0
2: 6
3: 45
4: 379
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395402_1061395422 21 Left 1061395402 9:130341092-130341114 CCCTCCTGTGGCCCCTCAGTCCC 0: 1
1: 2
2: 8
3: 74
4: 564
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395400_1061395422 30 Left 1061395400 9:130341083-130341105 CCTTGATACCCCTCCTGTGGCCC 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395413_1061395422 -2 Left 1061395413 9:130341115-130341137 CCCTCAGGTGCAGCCAGGCCCTC 0: 1
1: 0
2: 5
3: 25
4: 266
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395403_1061395422 20 Left 1061395403 9:130341093-130341115 CCTCCTGTGGCCCCTCAGTCCCC 0: 1
1: 0
2: 3
3: 54
4: 569
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395404_1061395422 17 Left 1061395404 9:130341096-130341118 CCTGTGGCCCCTCAGTCCCCCCT 0: 1
1: 0
2: 2
3: 39
4: 383
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395411_1061395422 0 Left 1061395411 9:130341113-130341135 CCCCCTCAGGTGCAGCCAGGCCC 0: 1
1: 0
2: 4
3: 27
4: 331
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395401_1061395422 22 Left 1061395401 9:130341091-130341113 CCCCTCCTGTGGCCCCTCAGTCC 0: 1
1: 0
2: 4
3: 49
4: 477
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395414_1061395422 -3 Left 1061395414 9:130341116-130341138 CCTCAGGTGCAGCCAGGCCCTCG 0: 1
1: 0
2: 5
3: 30
4: 290
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395406_1061395422 10 Left 1061395406 9:130341103-130341125 CCCCTCAGTCCCCCCTCAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 198
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1061395408_1061395422 8 Left 1061395408 9:130341105-130341127 CCTCAGTCCCCCCTCAGGTGCAG 0: 1
1: 0
2: 1
3: 23
4: 243
Right 1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061395422 Original CRISPR TCGGGTTCTGAAGGTGCTGG TGG Intronic
900190833 1:1351525-1351547 TCGGGCCCTGACCGTGCTGGGGG + Intergenic
901787949 1:11637198-11637220 TCTGGTTCTAGAGGGGCTGGAGG - Intergenic
909502755 1:76353860-76353882 TGGGGTTCTGAAGGTAAAGGGGG - Intronic
912712329 1:111958843-111958865 CTGGGTTCTGAGGGTGGTGGTGG + Intronic
916018052 1:160767960-160767982 TCTGGTTCTGGAGGTTCTGCAGG + Intergenic
921168286 1:212523258-212523280 GCGGGTGGTGAGGGTGCTGGTGG + Intergenic
923714675 1:236415057-236415079 TGGCGTTCTCAAGGTGGTGGAGG + Intronic
1063570881 10:7213588-7213610 ACGGGTTCTGACGGTTCTGCTGG + Intronic
1064674918 10:17750791-17750813 TCCTGTTCTGAAAGTGCTTGAGG - Intergenic
1067048171 10:42997541-42997563 GCTGTTTCTGAAGGTGATGGAGG - Intergenic
1070385296 10:75918663-75918685 TCTGCTTCTGAAGGTGTTGGAGG - Intronic
1072759363 10:98043149-98043171 CCAGGTTCTGAATGTGGTGGAGG - Intergenic
1075873300 10:125786839-125786861 CCTGGTTCTGAAGGTATTGGTGG - Intronic
1076310663 10:129504872-129504894 TCAGGTCCTAAAGGTGGTGGAGG - Intronic
1077045245 11:541827-541849 TGGGGTACTGAGCGTGCTGGGGG - Intronic
1077045255 11:541866-541888 TGGGGTACTGAGCGTGCTGGGGG - Intronic
1078398987 11:11007685-11007707 CTGGATTCTGAAGGTGCTGCAGG - Intergenic
1078602276 11:12743991-12744013 TCGGGTACTGGAGGTGGTGTGGG + Intronic
1079406984 11:20156336-20156358 GCGGGTCCCGCAGGTGCTGGGGG + Exonic
1082490901 11:53532295-53532317 TTGAGTTCTGGATGTGCTGGAGG - Intergenic
1084530220 11:69722886-69722908 TCGGCTTCCCAAAGTGCTGGGGG + Intergenic
1084698373 11:70769915-70769937 CTGGGTCCTGCAGGTGCTGGAGG + Intronic
1084721957 11:70912153-70912175 TCAGCTTATGAAGGTGGTGGTGG + Intronic
1085798351 11:79564422-79564444 TCGGGGTGTGGAGGTGCTTGTGG + Intergenic
1089066490 11:115665914-115665936 TTCAGTTCTGAAGGTGCTGCAGG + Intergenic
1090184123 11:124725272-124725294 TCAGGGCCTGAAGGTGCAGGGGG - Intergenic
1090420909 11:126574302-126574324 TGGGGCTCTGAAGGAGGTGGGGG - Intronic
1096452461 12:51755948-51755970 TCGGGTGCTGAAGGGGTGGGGGG - Intronic
1096975602 12:55697813-55697835 GCTGGTTCTCTAGGTGCTGGAGG - Exonic
1098981975 12:76966191-76966213 CCTGGTTCTGAGGGTGCTGGAGG - Intergenic
1100390459 12:94142324-94142346 AAGGGTTCAGAAGGTGGTGGGGG - Intergenic
1103320043 12:120087117-120087139 ACGGGTTCTGACGCTACTGGAGG + Intronic
1104921624 12:132293682-132293704 TCTGGCTCTGAATGTGCAGGGGG - Intronic
1104993812 12:132641927-132641949 GCTGGTTCTGGAGGTGGTGGTGG - Intronic
1105997713 13:25688005-25688027 TCGTGTCAGGAAGGTGCTGGAGG - Intronic
1107626677 13:42293746-42293768 TAGGGTTTTGAAGATGCCGGGGG - Intronic
1107655695 13:42590294-42590316 TAGGATTCTTAAGGGGCTGGAGG + Intronic
1107835918 13:44412529-44412551 TCTGTTTCTGAAGATGCGGGGGG + Intergenic
1108434028 13:50384013-50384035 TCAGGTTCCGAAGTTGCTTGTGG - Intronic
1112340816 13:98551630-98551652 GCAGTTCCTGAAGGTGCTGGTGG - Intronic
1113800537 13:113084235-113084257 TGGGGTTCAGGAGGTTCTGGGGG - Intronic
1113927730 13:113950844-113950866 TCTGGTTCTGAAGGCTGTGGTGG - Intergenic
1114034881 14:18614464-18614486 CTGGGTTGTGAAGTTGCTGGTGG - Intergenic
1114123764 14:19700552-19700574 CTGGGTTGTGAAGTTGCTGGTGG + Intergenic
1118930985 14:70240196-70240218 TCTGGTACAGAAGATGCTGGTGG - Intergenic
1119738546 14:76999373-76999395 TCAGGTTCTGTGGGAGCTGGAGG - Intergenic
1120607526 14:86597541-86597563 TGGGGCTGTGATGGTGCTGGGGG + Intergenic
1121511901 14:94518945-94518967 TCTGGTGGTGAAGGTGGTGGTGG + Intergenic
1122987084 14:105217457-105217479 TCGGGTCCTGGAGCTGCCGGGGG - Intronic
1123924430 15:25093939-25093961 TGGGCTTCTTCAGGTGCTGGTGG + Intergenic
1124177314 15:27438599-27438621 TCCTGTTCTGAAGGTGATGCTGG - Intronic
1124573385 15:30885965-30885987 CAAGGTCCTGAAGGTGCTGGTGG - Intergenic
1128758084 15:70196606-70196628 GCGGGTGCTGCTGGTGCTGGAGG - Intergenic
1129237425 15:74232136-74232158 TGGGGGTGTGAAGGGGCTGGTGG + Intergenic
1131363463 15:91816649-91816671 TTGGGTTTTGAAGGACCTGGAGG + Intergenic
1132627241 16:897353-897375 TCGGGGACTGTAGGGGCTGGGGG - Intronic
1135184342 16:20302061-20302083 CCAGGTTCTGAATTTGCTGGAGG + Intergenic
1135650119 16:24198588-24198610 TCTGCCTCTGAAAGTGCTGGGGG + Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1136461717 16:30415333-30415355 TCTGTTTCTGAAGCTGCAGGAGG - Intronic
1136619720 16:31420286-31420308 GAGGGTTCTGCAGGTGGTGGAGG + Intronic
1142415406 16:89938553-89938575 GCGTGTTCTGAAGGTGCAGCTGG - Intergenic
1142768110 17:2076972-2076994 TCCAATTCTGAAGGTGCTGCTGG + Intronic
1145797245 17:27662845-27662867 TGGGGATCTGAATGTGCTGTTGG + Intergenic
1147182912 17:38698035-38698057 TCTGGTCCTGCAGGTGCTTGGGG - Intergenic
1147200918 17:38800244-38800266 TAGGTGTCTGAAGGTGCTGGCGG - Intergenic
1147739882 17:42665517-42665539 ACGGGTTCTGGATGTGCAGGCGG - Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148126060 17:45237555-45237577 TCTGGTGCTGGAGCTGCTGGCGG + Exonic
1148786262 17:50147708-50147730 TGGGGTTCTGAAGGGAATGGGGG - Intronic
1149262995 17:54899896-54899918 TCTGGTTCTGAAGGGGCAGCTGG + Intronic
1149294100 17:55245371-55245393 TCAGGTTCTGAACCTGCTTGGGG + Intergenic
1152717895 17:81908676-81908698 CTGGGCTCTGAAGGTTCTGGTGG - Intronic
1152799013 17:82322508-82322530 CTGGGTTCTGAAACTGCTGGAGG + Intronic
1154334453 18:13454741-13454763 CCTGGTCCAGAAGGTGCTGGAGG + Intronic
1161356374 19:3821413-3821435 CCGGGCTCGGAAGGTCCTGGAGG - Exonic
1161905408 19:7152784-7152806 TCAGATCCTGAAGGAGCTGGAGG - Exonic
1162470323 19:10869276-10869298 CCGGGTCCTGGAGTTGCTGGGGG - Exonic
1162936636 19:13984633-13984655 TCGGCCTCTGGAGCTGCTGGGGG - Intronic
1163624675 19:18382371-18382393 TGGTGCTCTGAAGGTCCTGGTGG - Intronic
1164631935 19:29767685-29767707 ACGGGTGCTGAAGGGGCTGGTGG + Intergenic
1165128461 19:33617640-33617662 TTGGGTTTTCAAGGAGCTGGAGG - Intergenic
1165404208 19:35619942-35619964 TTGGGTTCTGGAGGCTCTGGGGG - Intronic
1165460090 19:35939354-35939376 AGGGGTTCTGCAGGGGCTGGGGG - Intronic
1167259469 19:48450387-48450409 GCGGCTTCTGCAGGTGGTGGAGG + Exonic
1167509872 19:49890431-49890453 GCGGAATCTGAAGGTGCTGAAGG - Exonic
1168407489 19:56118499-56118521 ACAGGTTCTGAAGCTGCTGGGGG + Intronic
925339511 2:3126413-3126435 GCTGCTTCTGAAGCTGCTGGCGG + Intergenic
926276636 2:11408321-11408343 TCATATTCTGAAGGTTCTGGTGG + Intergenic
927484366 2:23478668-23478690 TCGGGCTCTGGAGGTGGTGAAGG + Intronic
927864965 2:26582444-26582466 GGGGGATCTGAAGATGCTGGTGG - Intronic
932492795 2:72132400-72132422 GCTGTTCCTGAAGGTGCTGGCGG - Exonic
934658566 2:96130775-96130797 GTGGGGTATGAAGGTGCTGGAGG - Intronic
934775054 2:96932122-96932144 TTGGGGTCTGAGGCTGCTGGCGG - Intronic
938276372 2:130028386-130028408 CTGGGTTCTGAAGTTGCTGGTGG + Intergenic
938439004 2:131308969-131308991 CTGGGTTGTGAAGTTGCTGGTGG - Intronic
942046561 2:172102448-172102470 TCGGGGGCTGCTGGTGCTGGTGG + Exonic
942079241 2:172384920-172384942 TCGGGGTCTGCAGCTGCTGAGGG + Intergenic
942181489 2:173385004-173385026 TGGAGGTCTGAAGGGGCTGGAGG + Intergenic
943928170 2:193815367-193815389 TCAGATTCTCAAGGTGCTGATGG + Intergenic
944445390 2:199783700-199783722 TTGTGTCCTGAAGGTGCTGCTGG - Intronic
945992236 2:216405789-216405811 GCGGGTTCTGAATGAGCTGTAGG - Intergenic
947378246 2:229519690-229519712 TCGGGTTCAGAAGATGCGTGTGG + Intronic
947938322 2:234026207-234026229 ATGGGTTTTGAAGGGGCTGGAGG - Intergenic
1169268549 20:4182199-4182221 GCGGGTTGTGGAGCTGCTGGCGG + Exonic
1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG + Intronic
1174117603 20:48237970-48237992 GAGGGTTCTCAAGGGGCTGGGGG - Intergenic
1175174692 20:57104191-57104213 TCGGGGACGGAAGGTGCGGGGGG - Intergenic
1177058400 21:16338458-16338480 TGGGGCACTGAAGGTACTGGGGG + Intergenic
1180459001 22:15541512-15541534 CTGGGTTGTGAAGTTGCTGGTGG - Intergenic
1182430770 22:30297695-30297717 GCAGGCTCTGCAGGTGCTGGTGG - Intronic
951712198 3:25594521-25594543 TCGGTTCCTCAAGGTCCTGGCGG - Exonic
954114032 3:48454415-48454437 TCAGGTAATGATGGTGCTGGAGG + Exonic
954314301 3:49792854-49792876 TGTGGTTCTGTGGGTGCTGGTGG + Exonic
956888336 3:73583588-73583610 TTGGGTCCTGAAGGTGCTTATGG - Intronic
960056521 3:113279846-113279868 CCGGGCTCTGAACATGCTGGGGG + Exonic
960154658 3:114287051-114287073 TCAGGCTCTGAATCTGCTGGTGG - Intronic
961708215 3:128806466-128806488 TAGGGTTTTGAATGTGTTGGGGG - Exonic
961845845 3:129762290-129762312 TCGGTTTCCCAAAGTGCTGGGGG + Intronic
966414322 3:179673487-179673509 TCAGCTTCTAAAGGTACTGGCGG + Intronic
968815368 4:2818787-2818809 TTGGGTGCAGAAGGAGCTGGTGG + Intronic
969357834 4:6641096-6641118 CCGGGTTCTGGAGGTGGTTGAGG - Exonic
969626461 4:8308059-8308081 TGGGGTCCTGTAGGTTCTGGGGG + Intergenic
972696323 4:41450079-41450101 TCACATTCTGAAGGTACTGGGGG + Intronic
978683968 4:111416168-111416190 TCAGATTTTGAAGGTCCTGGTGG + Intergenic
983730820 4:170991611-170991633 TTGAGTTCTGGATGTGCTGGAGG + Intergenic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
993443509 5:87983633-87983655 TCAGTTTCTGAAGGTTTTGGAGG - Intergenic
995578260 5:113565348-113565370 TCTGCTTTTGAAGGAGCTGGGGG - Intronic
997709304 5:135990533-135990555 GAGGGTGCTGGAGGTGCTGGAGG + Intergenic
1000253920 5:159520114-159520136 TCACATTCTGAAGGTACTGGAGG + Intergenic
1002843654 6:926957-926979 TCAGGTGCTGAAGGAGCTGCTGG + Intergenic
1003640270 6:7869977-7869999 TCCTGTTCTGAGGGTGGTGGTGG - Intronic
1004158801 6:13195122-13195144 TCGTGTTCTGAAGGAACTGATGG + Intronic
1006134941 6:31889391-31889413 TCTGGTCCTGAAGGTGTTGGGGG - Intronic
1012178874 6:96125674-96125696 TGGGGCTCTGAGGGTGCAGGTGG - Intronic
1014966183 6:127755121-127755143 ACGTGTTCTGTAGATGCTGGCGG - Intronic
1017351513 6:153448148-153448170 TCAGGGTCTCAAGGTGCAGGAGG + Intergenic
1017683100 6:156883749-156883771 GCAGGTGCTGGAGGTGCTGGAGG + Intronic
1017816801 6:158022096-158022118 TAGGGTTCTGAACCTGCGGGTGG + Intronic
1020752233 7:12156633-12156655 GCAGGTTGTGAAGGTGATGGTGG - Intergenic
1020917109 7:14208316-14208338 TCGGGTTTTTAAACTGCTGGTGG + Intronic
1022104481 7:27188422-27188444 TCGTGTTCGGAATATGCTGGCGG + Intergenic
1022788631 7:33664290-33664312 TCAGGTCCAGAAGGTCCTGGAGG + Intergenic
1022972407 7:35530160-35530182 TCGGGTGCTGGGGGTGCTGGGGG - Intergenic
1024192593 7:47027929-47027951 TCAGATTCTCAAGGAGCTGGTGG - Intergenic
1027695155 7:81401431-81401453 TCTGAGTCTGAACGTGCTGGAGG - Intergenic
1027815603 7:82966390-82966412 TTGGGTCCTGATGGTGCAGGTGG + Exonic
1028173789 7:87629151-87629173 TCCAGTGCTGAAGGTACTGGAGG + Intronic
1028753117 7:94404836-94404858 TAGGGTCCTGCAGGTGCTCGTGG + Exonic
1028983403 7:96992045-96992067 ACGTCTTCTGAAGGGGCTGGGGG + Intergenic
1030323865 7:108199503-108199525 TCGCTTTCTGAAGGTTCTAGGGG + Intronic
1030636236 7:111952336-111952358 TAGGGATCTGAAGGTCCTGATGG + Intronic
1032120236 7:129150098-129150120 TCCTGTTTTGAAGGTGATGGTGG - Intronic
1032464405 7:132134810-132134832 GAGGGTTCTGAAGGTGGAGGAGG - Intronic
1035035613 7:155892152-155892174 TGTGGTTGTGAAGGTGGTGGTGG + Intergenic
1035035632 7:155892248-155892270 TGTGGTTGTGAAGGTGGTGGTGG + Intergenic
1035035693 7:155892520-155892542 TGTGGTTGTGAAGGTGGTGGAGG + Intergenic
1035328958 7:158084201-158084223 TCTGCTGCTGATGGTGCTGGGGG - Intronic
1036751930 8:11449109-11449131 TCGCGGTCTGACTGTGCTGGGGG - Intronic
1040616563 8:49043501-49043523 TCTCCTTCTGTAGGTGCTGGGGG - Intergenic
1043878047 8:85508828-85508850 CTGGGTTCTGAAGGAGCTGGTGG - Intergenic
1046757653 8:117988631-117988653 TGGGGTTGGGAGGGTGCTGGAGG - Intronic
1047506736 8:125486228-125486250 CCGTGTTCTGATGGAGCTGGTGG - Intergenic
1047797549 8:128273452-128273474 TCTGGTTCAGAAGGTCCAGGTGG - Intergenic
1049292659 8:141812843-141812865 TCAGGGTATGAGGGTGCTGGGGG - Intergenic
1049292674 8:141812889-141812911 TCAGGGTATGAGGGTGCTGGGGG - Intergenic
1049292757 8:141813118-141813140 TCAGGGTATGAGGGTGCTGGGGG - Intergenic
1049292921 8:141813573-141813595 TCAGGGTGTGAGGGTGCTGGGGG - Intergenic
1053157779 9:35792257-35792279 TGGGATGCAGAAGGTGCTGGGGG - Exonic
1061083168 9:128384341-128384363 TCTGAGTCTGTAGGTGCTGGCGG - Intronic
1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG + Intronic
1186784949 X:12948581-12948603 ACTGGTTCTCAAGGTGGTGGGGG + Intergenic
1187454353 X:19428271-19428293 GCGGCTTCAGAAGGTGGTGGCGG - Intronic
1192312410 X:70027898-70027920 TGGGGTCCTGGAGGTCCTGGGGG - Exonic
1192504150 X:71670697-71670719 TGTCGTTCTGCAGGTGCTGGTGG + Intergenic
1192546471 X:72018659-72018681 TCGTGTTCCGGAGGTGCTGAGGG - Intergenic
1195574202 X:106431541-106431563 TGGGCATCTGAAGGGGCTGGAGG - Intergenic
1195779014 X:108440091-108440113 GCGGGTGCTGAAGGAGCTGCGGG + Exonic
1196081422 X:111637012-111637034 TCGGCTTCCCAAAGTGCTGGGGG + Intergenic