ID: 1061396937

View in Genome Browser
Species Human (GRCh38)
Location 9:130348547-130348569
Sequence CCGTCCTCCCGGATGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061396937_1061396951 8 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396951 9:130348578-130348600 CCAACGTGTCGGGTATGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 36
1061396937_1061396947 -2 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396947 9:130348568-130348590 GGGCGCAAGGCCAACGTGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1061396937_1061396952 24 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396952 9:130348594-130348616 GGCCGGGCAGTCCCTGACGCTGG 0: 1
1: 0
2: 0
3: 13
4: 146
1061396937_1061396949 7 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396949 9:130348577-130348599 GCCAACGTGTCGGGTATGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 41
1061396937_1061396946 -3 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396946 9:130348567-130348589 CGGGCGCAAGGCCAACGTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1061396937_1061396948 3 Left 1061396937 9:130348547-130348569 CCCCCCAGCATCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1061396948 9:130348573-130348595 CAAGGCCAACGTGTCGGGTATGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061396937 Original CRISPR CCGTCCTCCCGGATGCTGGG GGG (reversed) Intronic
900001867 1:18919-18941 CCATCCTCCCTGGTGCGGGGTGG + Intergenic
900292396 1:1929044-1929066 CTGTCCCCCAGGAGGCTGGGCGG + Intronic
900435526 1:2629008-2629030 CCGGACTCCCGGAGGGTGGGGGG - Intronic
901528988 1:9842101-9842123 CCCTCCTCTGAGATGCTGGGAGG - Intergenic
901823983 1:11848515-11848537 CCCTCCTCCAGCATGCTGCGGGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903859099 1:26354436-26354458 GCGTCTTCCAGGTTGCTGGGTGG + Intergenic
904339333 1:29824069-29824091 CCGTCCTGCAGTATGGTGGGAGG + Intergenic
904697027 1:32336438-32336460 CAGTCCTCCCGCGAGCTGGGCGG + Intergenic
905738627 1:40350015-40350037 CAGGCCTCCCGGAGGCTGTGGGG + Intronic
905945492 1:41898110-41898132 CCTGCCCCCAGGATGCTGGGAGG - Intronic
908535545 1:65073191-65073213 CCTTCCTCCCAGCTGCTGGCTGG + Intergenic
912801580 1:112722915-112722937 CCCTCCTCCCTGCTGCAGGGAGG - Intronic
912861908 1:113220799-113220821 GCTTCCTCTCGGCTGCTGGGAGG - Intergenic
922575171 1:226656293-226656315 CCCTCCTCCTGGATGCTGTGAGG - Intronic
924926849 1:248691983-248692005 CAGCGCCCCCGGATGCTGGGTGG - Intergenic
1063141864 10:3262962-3262984 TCGTCCTCCTGGCTGCTGTGCGG + Intergenic
1063535243 10:6876753-6876775 CCTTCCCCCCGGCTGCTGGCTGG - Intergenic
1064017477 10:11783795-11783817 CCGCCCTGCCAGAGGCTGGGCGG - Intergenic
1069836544 10:71312806-71312828 CCCTCCCCCTGGATCCTGGGTGG + Intergenic
1070828222 10:79403550-79403572 GCGGCCTGCAGGATGCTGGGAGG + Intronic
1072745179 10:97934681-97934703 CCGGCCTCCAGGAGGTTGGGAGG + Intronic
1076644648 10:131944608-131944630 CCATGCTCCCGGCTGCTGGCTGG - Intronic
1084434025 11:69127532-69127554 GCCTCCTCCTGGGTGCTGGGTGG - Intergenic
1084684697 11:70686761-70686783 CCTTCCTCCAGGAAGCAGGGAGG - Intronic
1086336561 11:85806963-85806985 CCGTGCTCCTGGATGCTCTGAGG - Intronic
1089301452 11:117501530-117501552 CCCTCCTGCTGGATTCTGGGTGG + Intronic
1089695844 11:120215922-120215944 CTATCCTCCCTGATGCTGGGAGG - Intronic
1091374946 12:19024-19046 CCATCCTCCCTGGTGCGGGGTGG + Intergenic
1091398392 12:168411-168433 CCGTCCTCCCAGGCGCCGGGTGG + Intronic
1091916494 12:4274332-4274354 CCGGCCTCCCGGCTCCTGTGCGG + Intronic
1096475812 12:51908033-51908055 ACGTCCTCCAGGCCGCTGGGTGG + Intronic
1098342944 12:69470509-69470531 CCGTCCGCCCAGGTGCTGAGAGG - Exonic
1101998094 12:109539477-109539499 CCGGCCTCCCAGATCGTGGGCGG - Intergenic
1103885808 12:124199218-124199240 CTGTCCTCCCGGAGTCTGAGAGG - Intronic
1113741813 13:112716496-112716518 CCGTCCTCCCAGAGGCGGAGGGG - Intronic
1117289214 14:54316232-54316254 CCTTCCTCCCTGATGGAGGGTGG - Intergenic
1118336108 14:64854750-64854772 CCATCCTCCAGGATGCCGGCAGG + Intronic
1122782426 14:104149354-104149376 CCGGCCTCCAGGATGCTGGCTGG + Intronic
1122843181 14:104476660-104476682 CCCTCCACCAGCATGCTGGGAGG + Intronic
1122895236 14:104753433-104753455 CCGCGTTCCCGGAAGCTGGGAGG + Intronic
1122924879 14:104894924-104894946 CCTTCCTCCCTGATGCCGAGAGG + Exonic
1123072997 14:105651268-105651290 CCGTCCTCCCCCAGCCTGGGAGG - Intergenic
1123092921 14:105750037-105750059 CCGTCCTCCCCCAGCCTGGGAGG - Intergenic
1123098400 14:105777137-105777159 CCGTCCTCCCCCAGGCTGGGAGG - Intergenic
1123107544 14:105849721-105849743 CCATCCTCCCCCAGGCTGGGAGG + Intergenic
1125806136 15:42495459-42495481 CAGTCCTGCCCGAAGCTGGGAGG - Exonic
1129428252 15:75480700-75480722 CCATCCTCCCGGCTGTGGGGCGG - Intronic
1129823385 15:78619503-78619525 GTGTTCTCCCGGAGGCTGGGAGG - Intronic
1132402259 15:101519799-101519821 CCATCCACCTGGAAGCTGGGAGG - Intronic
1132451642 15:101972021-101972043 CCATCCTCCCTGGTGCGGGGTGG - Intergenic
1132455247 16:18608-18630 CCATCCTCCCTGGTGCGGGGTGG + Exonic
1132710715 16:1265912-1265934 CCTGCCTCCCGGCAGCTGGGTGG - Intergenic
1132932151 16:2464309-2464331 CCATCCTCCTGGGTCCTGGGGGG - Intronic
1133076859 16:3286446-3286468 CAGTATTCCAGGATGCTGGGGGG + Intronic
1134188043 16:12099674-12099696 AAGTCCTCCCAGATGCTGGTGGG - Intronic
1140479571 16:75255250-75255272 CCACCCTCCCTGCTGCTGGGAGG - Intronic
1142037271 16:87869764-87869786 CCGTCCTCCCGGATGCGCCTGGG + Intergenic
1143090899 17:4448637-4448659 CCCTTCTCCGGGTTGCTGGGAGG + Intronic
1143203917 17:5130275-5130297 CCGGGCTCCCAGATGCTGGCTGG - Intronic
1144849428 17:18236596-18236618 CCGTCCTCATGGCTGCAGGGAGG - Exonic
1146844653 17:36175121-36175143 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1146856959 17:36263056-36263078 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1146863658 17:36325319-36325341 CCGGGCTCCCAGATGCTGGCTGG - Intronic
1146872869 17:36386966-36386988 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1146880227 17:36438052-36438074 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1147066518 17:37925907-37925929 CCGGGCTCCCAGATGCTGGCTGG - Intronic
1147075753 17:37987591-37987613 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1147078050 17:38005468-38005490 CCGGGCTCCCAGATGCTGGCTGG - Intronic
1147087278 17:38067137-38067159 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1147093986 17:38129403-38129425 CCGGGCTCCCAGATGCTGGCTGG - Intergenic
1147103223 17:38191100-38191122 CCGGGCTCCCAGATGCTGGCTGG + Intergenic
1147263073 17:39219965-39219987 CTGGCCTCCCGGAGGCTGGTGGG - Intronic
1147967467 17:44200590-44200612 CAGTTCTCCCGGTTTCTGGGCGG + Intergenic
1148153180 17:45408515-45408537 CCTTCCTCCAGGCTGCTGTGTGG + Intronic
1149847798 17:60017569-60017591 CCGGGCTCCCAGATGCTGGCTGG + Intergenic
1150086154 17:62274186-62274208 CCGGGCTCCCAGATGCTGGCTGG + Intronic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1152109257 17:78348260-78348282 CCGTCCACCCAGACCCTGGGGGG - Intergenic
1153814907 18:8783707-8783729 TCGGCCTCCCGGGTGCTGGGGGG - Exonic
1157609252 18:48946012-48946034 CAGGCCTCCCAGATGCTGAGTGG + Intronic
1160633619 19:60527-60549 CCATCCTCCCTGGTGCGGGGTGG + Intergenic
1160724310 19:610857-610879 CCGGCCTCCAGGACGGTGGGAGG - Intronic
1161378159 19:3950626-3950648 TCGTCCTCCCGGAAGCTCAGTGG - Intergenic
1161554441 19:4932733-4932755 CCGTTCTCCGGGTAGCTGGGAGG - Exonic
1164039706 19:21483739-21483761 CCCTCCTCCCCGCTGCTGAGTGG - Intronic
1167735226 19:51290464-51290486 CCAGCCTCCAGAATGCTGGGAGG - Intergenic
927151438 2:20198643-20198665 CCTTTCTCCCAGATGCTGTGGGG + Intergenic
932702855 2:74002852-74002874 CCGTCCTCTCGGATCTCGGGGGG + Intronic
934937994 2:98479053-98479075 ACTTCCTCCCGGCTCCTGGGTGG + Intronic
936288773 2:111201526-111201548 CCCTCCTCCCAGCTGCTGGAGGG + Intergenic
936567855 2:113594488-113594510 CCATCCTCCCTGGTGCAGGGTGG - Intergenic
937325859 2:120989269-120989291 CCCTCCGCCCCTATGCTGGGAGG + Exonic
938117301 2:128610683-128610705 TCGGCCACCCGGATCCTGGGAGG - Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946330130 2:219004285-219004307 CCATCCTCCCAGCTGCTGGAGGG + Exonic
947791450 2:232871596-232871618 ACTTCCTCCCGCAAGCTGGGAGG + Intronic
948954014 2:241272938-241272960 TGGGCCTCCCGGGTGCTGGGCGG - Intronic
1169046538 20:2538033-2538055 CCTTCCTCCCCCATTCTGGGAGG + Intronic
1170141634 20:13130743-13130765 CCATCCTAATGGATGCTGGGTGG + Intronic
1171545545 20:25997889-25997911 CTGTCCTCCCAGAAGCTGGAGGG - Intergenic
1171879040 20:30603125-30603147 CTCTCCTCCTGGCTGCTGGGTGG - Intergenic
1175169436 20:57069936-57069958 CTGTCTTCCCGGAAACTGGGCGG - Intergenic
1175605119 20:60306435-60306457 CCCTCTTCCCTGGTGCTGGGAGG - Intergenic
1175826137 20:61937641-61937663 CACCCCTCCCGGATGCTGTGAGG + Exonic
1176150935 20:63590393-63590415 CCGGCCTCCCCGCTGCTCGGGGG - Exonic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1176952468 21:15064331-15064353 CTGTCCAGCCGGATCCTGGGCGG - Intronic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1180618291 22:17143195-17143217 CCCACCTCCAGGGTGCTGGGAGG + Intronic
1180762276 22:18219850-18219872 CCCTCCGCCCGGGTGCGGGGAGG - Intergenic
1180773391 22:18404758-18404780 CCCTCCGCCCGGGTGCGGGGAGG + Intergenic
1180804742 22:18654307-18654329 CCCTCCGCCCGGGTGCGGGGAGG + Intergenic
1180806002 22:18715103-18715125 CCCTCCGCCCGGGTGCGGGGAGG - Intergenic
1180885591 22:19241033-19241055 CGGTCCTCCCGGCTGCAGGGTGG - Intronic
1181192487 22:21151691-21151713 CCCTCCGCCCGGGTGCGGGGAGG + Intergenic
1181216952 22:21340884-21340906 CCCTCCGCCCGGGTGCGGGGAGG - Intergenic
1183342767 22:37290929-37290951 CCATCCCCCCAGCTGCTGGGAGG - Intronic
1183708285 22:39488179-39488201 CCGTCCTGCCGGCCGCCGGGCGG - Exonic
1203235221 22_KI270731v1_random:145740-145762 CCCTCCGCCCGGGTGCGGGGAGG + Intergenic
961435038 3:126911152-126911174 CAGTCCTCCCAGGTGCTGTGGGG - Intronic
966912276 3:184566219-184566241 CCGTCCTTCTGGCTGCTGGCAGG + Intronic
968057953 3:195707310-195707332 CCGTCCTACTGGATGTGGGGTGG + Intergenic
968606488 4:1538029-1538051 CAGTCCTCCTGGGTCCTGGGAGG + Intergenic
968731543 4:2271526-2271548 CCGCCCCCCCGGAGGCTGGCTGG - Intronic
969056992 4:4408281-4408303 GCATCCTCCAGGCTGCTGGGAGG + Intronic
969398396 4:6938028-6938050 CACTCCTCCCGGGTGCTGGGTGG + Intronic
969709781 4:8836096-8836118 CCGTCCACCCGGAAGCAGGTGGG + Intergenic
969925748 4:10584181-10584203 CAGTTCTCCCAGCTGCTGGGTGG + Intronic
974523055 4:63010385-63010407 CAGTCCTCCTGGGTGCTGCGTGG + Intergenic
985045729 4:185938742-185938764 CTGGCCTCCAGGCTGCTGGGGGG - Intronic
987399884 5:17464025-17464047 CCCTCCTCCCGGAGGTTCGGTGG + Intergenic
991711777 5:69415368-69415390 CCGTCCTTCCGGGCGCGGGGCGG + Intronic
996823519 5:127655894-127655916 CCTTCCTCCCAGATCCTGGCTGG + Intronic
997978268 5:138453092-138453114 CTGCCCTCCCGCATGCTGGAAGG + Intergenic
998399140 5:141839017-141839039 CCATCCTCCCCAATCCTGGGGGG + Intergenic
998594506 5:143514689-143514711 CCTCCATCCAGGATGCTGGGGGG - Intergenic
1003159871 6:3625663-3625685 CCGACCTCCTGCATGCTGTGTGG + Intergenic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1011195404 6:84774633-84774655 CCGGCCTGCCGGATGGTGGCGGG + Intergenic
1017590604 6:155974657-155974679 CCGTACTGCCAGATGCTGGGAGG + Intergenic
1018711676 6:166501769-166501791 CTGTTCTTCCAGATGCTGGGAGG + Intronic
1019078633 6:169412008-169412030 CAGTCCTCATGGATGCTGTGTGG - Intergenic
1019101498 6:169634401-169634423 CCTTTCTCCCGGATCCTGGTAGG - Intronic
1023520676 7:41047231-41047253 CAGTCCTCCTGGATGCTGCCTGG + Intergenic
1023609256 7:41957273-41957295 CCGGCCTCCTGGGGGCTGGGAGG + Intergenic
1035016610 7:155772172-155772194 CAGTGCTCCAGGATCCTGGGGGG - Intronic
1035244467 7:157553342-157553364 CCGCCCTCCCGAATTCTGGCCGG + Intronic
1039553307 8:38458880-38458902 CAGTTCTCCCTGATGCTGGAAGG + Intronic
1043802810 8:84632122-84632144 CTGTCCTCTCGCATGGTGGGAGG - Intronic
1049299724 8:141863104-141863126 CCGTCTGGCAGGATGCTGGGTGG + Intergenic
1049884675 9:19032-19054 CCATCCTCCCTGGTGCGGGGTGG + Intergenic
1053010656 9:34630971-34630993 CAACCCTCCCTGATGCTGGGAGG + Intergenic
1053903418 9:42817576-42817598 CCGTCCTCCTGAATCCTAGGTGG - Intergenic
1061396937 9:130348547-130348569 CCGTCCTCCCGGATGCTGGGGGG - Intronic
1061669513 9:132180730-132180752 GGGTCTTCCTGGATGCTGGGAGG - Intronic
1061872523 9:133528437-133528459 CCCACCTCCCGGCTGCTGGAAGG - Intronic
1062346951 9:136119283-136119305 CCGCCCTCCTGGAGCCTGGGGGG - Intergenic
1189463528 X:41261215-41261237 CCCTCCTCCCGGATATGGGGCGG + Intergenic
1190643265 X:52501391-52501413 GCCTCTTCCCGAATGCTGGGGGG - Intergenic
1190644407 X:52511476-52511498 GCCTCTTCCCGAATGCTGGGGGG + Intergenic
1193945438 X:87728143-87728165 CTGACCTCCCTGATGCTGGGAGG + Intergenic
1200401132 X:156021120-156021142 CCATCCTCCCTGGTGCGGGGTGG - Intergenic
1201178398 Y:11323203-11323225 GCGTCCTCCCATGTGCTGGGTGG + Intergenic