ID: 1061400981

View in Genome Browser
Species Human (GRCh38)
Location 9:130368275-130368297
Sequence GGTCAACCCCTCCCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061400968_1061400981 22 Left 1061400968 9:130368230-130368252 CCTTGCAAATGCCCTGGACCAGG 0: 1
1: 0
2: 2
3: 30
4: 235
Right 1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 113
1061400970_1061400981 11 Left 1061400970 9:130368241-130368263 CCCTGGACCAGGAGTTTCTTTTT 0: 1
1: 0
2: 1
3: 34
4: 336
Right 1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 113
1061400971_1061400981 10 Left 1061400971 9:130368242-130368264 CCTGGACCAGGAGTTTCTTTTTT 0: 1
1: 0
2: 4
3: 76
4: 683
Right 1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 113
1061400972_1061400981 4 Left 1061400972 9:130368248-130368270 CCAGGAGTTTCTTTTTTCCTGCA 0: 1
1: 0
2: 5
3: 37
4: 373
Right 1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061400981 Original CRISPR GGTCAACCCCTCCCCGGGGA GGG Intronic
900139391 1:1133241-1133263 GGTCACACCCACCCCAGGGAAGG + Intergenic
900246182 1:1637189-1637211 GGTCTTCACCTCCCCTGGGAGGG + Exonic
900257409 1:1704331-1704353 GGTCTTCACCTCCCCTGGGAGGG + Exonic
900265041 1:1753175-1753197 GGGCAGCCCCTCCCCGAGGCAGG + Intronic
900290944 1:1923345-1923367 GGTGAGCCCCTCCCCAGGGAGGG - Exonic
900389926 1:2429368-2429390 GTTAATCCCCTCCCCAGGGAGGG + Intronic
900421026 1:2556010-2556032 CTTCCACCCCTCCCAGGGGACGG + Intronic
900786332 1:4653005-4653027 TGCAAACACCTCCCCGGGGAGGG + Intergenic
900931961 1:5743362-5743384 GCTCATCCCCTCCCCATGGAGGG + Intergenic
901846265 1:11984676-11984698 GGTCCACCCCTCTCAGGGGAGGG - Intronic
901940014 1:12654847-12654869 GGTCACCCCTACCCCGGAGAGGG - Intronic
902509074 1:16955813-16955835 GGTCTACCCCTCCCAGCCGAGGG + Intronic
902571955 1:17352670-17352692 AGTCCTCCCCTCCCAGGGGATGG - Intronic
903464828 1:23544910-23544932 GGTCAACCAGTCACCTGGGAAGG - Intergenic
903659728 1:24969736-24969758 GATCAGCCCCTCTCCGGGGGTGG + Intergenic
906509383 1:46402219-46402241 GGCCAGCCCCTCCCTGGGAAAGG + Intronic
913521326 1:119648026-119648048 GCTCAACCGCCTCCCGGGGATGG - Intergenic
917147845 1:171911743-171911765 CGTCAACCCCTCCCCTGCTAAGG - Intronic
919907082 1:202085560-202085582 GGACAGCCCCACCCCGGGTAGGG + Intergenic
920198635 1:204245633-204245655 GAACAACCCCTCCCGGGGCACGG - Exonic
922800333 1:228362097-228362119 TGTGGACCCTTCCCCGGGGATGG - Intronic
1063067328 10:2623325-2623347 GGTAAACCCCTCCCCAGAGCTGG + Intergenic
1070584041 10:77747702-77747724 GGGCAAGCCCTTCCCGGGTAAGG + Intergenic
1075125581 10:119696504-119696526 CTTCAACCTCTCCCCTGGGAGGG - Intergenic
1076547769 10:131257284-131257306 GGACACCCCATCCCCTGGGAGGG + Intronic
1076783321 10:132736492-132736514 CGTCAGCCCCTCTCCGAGGACGG - Intronic
1076909975 10:133382414-133382436 GCTCATCCCTGCCCCGGGGAGGG - Intronic
1077526413 11:3068225-3068247 GCTCAGACCCTCCCAGGGGATGG - Intergenic
1078514364 11:12009398-12009420 GGCCCACCCCGCCCCGCGGAGGG + Intronic
1078840284 11:15071685-15071707 AGTCGCCCCCTCCCCTGGGAAGG - Intronic
1082174888 11:49048540-49048562 TGCCGACCCCTCCCCGCGGAAGG - Intergenic
1082657706 11:55872966-55872988 TGTCGACCCCGCCCCGCGGAAGG - Intergenic
1083651363 11:64206657-64206679 GTTCAGCCCCTCCCCAGGGCGGG - Intronic
1086690886 11:89787546-89787568 TGCCGACCCCTCCCCGCGGAAGG + Intergenic
1089672059 11:120063379-120063401 GGCTAATCCCTCCCTGGGGAGGG - Intergenic
1091498353 12:991453-991475 GGGCAACGCGCCCCCGGGGAGGG + Intronic
1091801312 12:3326414-3326436 AGGCAACTCCTCCCAGGGGAGGG - Intergenic
1092262446 12:6959866-6959888 GGTACCCCCCTTCCCGGGGAGGG + Intronic
1092262450 12:6959873-6959895 AGTCAAGCCCTCCCCGGGAAGGG - Intronic
1098701443 12:73632853-73632875 GGTCAAATCCTTCCAGGGGATGG + Intergenic
1102571874 12:113831731-113831753 GGACAGCCGCTCCCGGGGGAAGG + Intronic
1103618529 12:122171188-122171210 GCCCAACCACTGCCCGGGGAGGG + Intronic
1106312011 13:28562919-28562941 GATCATCCCCTCCCAGGGGAAGG - Intergenic
1107599858 13:42002399-42002421 CCTCAACCTCTCCCCAGGGAAGG + Intergenic
1108356243 13:49630914-49630936 GGGCAGCCCCTCCCCAGTGAGGG - Exonic
1112294692 13:98176723-98176745 GGGCAACTCCTCCTCGGGGATGG - Exonic
1113707314 13:112443283-112443305 GCTCCACCCAGCCCCGGGGACGG - Intergenic
1119428558 14:74551324-74551346 CGTGAACCCCTCCCTGGTGAAGG - Exonic
1119796055 14:77398475-77398497 GGTCTACCCTTCCACGTGGAAGG + Intronic
1121279027 14:92686787-92686809 GGGCTTCCCCTCCCCAGGGAAGG - Intronic
1122784582 14:104157874-104157896 GGTCACCCCCACCCCGGGCTCGG + Exonic
1122982946 14:105199748-105199770 GGCCAGCCCCTCCTCTGGGAAGG + Intergenic
1124207951 15:27739268-27739290 GGTCAACTCCACCCCTAGGAAGG + Intergenic
1127288749 15:57552350-57552372 TGTCAACAACTCCCAGGGGATGG + Intergenic
1128732998 15:70033669-70033691 GGTCCTCCCTGCCCCGGGGAGGG - Intergenic
1129659241 15:77543689-77543711 GGACAAGCCCTCCCTGGGCATGG - Intergenic
1133774744 16:8887701-8887723 GGTCACACCAGCCCCGGGGAAGG + Intergenic
1139614905 16:68083104-68083126 GGTCAGCCCCTCCACTGGGAAGG - Intergenic
1140990359 16:80205129-80205151 GGTGAACCCTTCCCCTGGCAGGG - Intergenic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1143639857 17:8189768-8189790 GGGCAAGCCCTCCTCCGGGAGGG - Exonic
1143778817 17:9218646-9218668 GGTAAGCCCCACCCCGGGGGTGG - Intronic
1146747747 17:35346786-35346808 GGTGACCCCCTCCCAGGGCAGGG - Intergenic
1146896427 17:36545152-36545174 GGTCGATCCCTCCCAGGGGCGGG + Intronic
1150251025 17:63704508-63704530 GGTCAGCTCCTCAGCGGGGATGG + Exonic
1152307306 17:79528829-79528851 GGTCATCCCCTGCGAGGGGAGGG - Intergenic
1152375421 17:79916214-79916236 GGTCAGCCCCTCCCTGGGAAGGG - Intergenic
1161017536 19:1990730-1990752 GGTGAAGCCCTCCGCGGTGATGG + Exonic
1161123654 19:2544102-2544124 CGTCAGCCCTTCCCCGTGGAGGG + Intronic
1161287912 19:3478367-3478389 TGTGAACCCCTCCTCGGGGTGGG - Intronic
1161338874 19:3729946-3729968 GGGCACCCCCTCCCCAGGGAGGG + Intronic
1162061164 19:8096376-8096398 GGTCTAAACCTCCCCTGGGATGG - Intronic
1162743119 19:12784146-12784168 GGTCAGCCCCTCCCGGGGCAGGG + Intronic
1162927593 19:13938067-13938089 GAGCATCCCCTCCTCGGGGAGGG + Intronic
1166354134 19:42217171-42217193 GGCCTCCCCCTCCCCCGGGAGGG + Intronic
1166529361 19:43533494-43533516 GGACGGCCCCTCCCCGGGGGCGG - Exonic
1167345653 19:48944208-48944230 GGTCCAAAGCTCCCCGGGGATGG + Intronic
1168284837 19:55325855-55325877 GTACATCCCCTCCCTGGGGAAGG - Intronic
925718151 2:6803689-6803711 GCTCAAGCCCTCCCTGGGGAAGG - Intergenic
932517442 2:72367682-72367704 GTTCAACCACTGCCAGGGGATGG - Intronic
937335928 2:121062356-121062378 GGTCAACCCATCCCCTAGTAAGG + Intergenic
937365373 2:121257318-121257340 GCCCCACCCCTCCCCCGGGAGGG - Intronic
941662002 2:168204477-168204499 CCTCAACCCCTGCCCAGGGAAGG + Intronic
941769668 2:169331083-169331105 GGTCTACCCCTTCAAGGGGAGGG + Intronic
942084079 2:172428050-172428072 GGCCAACTACTCCCCGGGGCCGG - Intronic
942681295 2:178480414-178480436 GGGAAACCCCTCCCCGGCGGCGG - Intergenic
1169048740 20:2558864-2558886 GGGCTGCCTCTCCCCGGGGAGGG - Intronic
1169770610 20:9195904-9195926 AGTCCACCCCTCCCCAGGCATGG - Intronic
1171485378 20:25481937-25481959 GGTCAGCCCCCTCCCAGGGACGG + Intronic
1174188007 20:48720730-48720752 GGTCAACACCTCCCTGGCAATGG + Intronic
1176130880 20:63496334-63496356 GATAAACCCCTCCCGGGCGAGGG + Intronic
1179186248 21:39087333-39087355 GGCCAGCCCCTCCCCGTGCAGGG + Intergenic
1180835797 22:18928808-18928830 GGTCCACCCCCCCCCCGGGTGGG + Intronic
1182114757 22:27749802-27749824 GGGCAACCCCACCCCTGGGAGGG - Exonic
1185213582 22:49585969-49585991 GGTCAGCCCCGGCCCAGGGATGG - Intronic
954807193 3:53227359-53227381 GGTCTCCCCCTGCCTGGGGATGG + Intronic
955414502 3:58679985-58680007 GGGCAAACCCTCCTCGGGCATGG + Intergenic
961037447 3:123652535-123652557 GGGCACCCCCGCCCCGGAGACGG + Intronic
964812211 3:160677819-160677841 GGCCAGCCCCTCCCCTGTGAGGG - Exonic
968912604 4:3483762-3483784 GGTCCACCCCTCCCTGTGAAGGG - Intronic
976223692 4:82778566-82778588 TGTCCTCCCCTCCCTGGGGATGG - Intronic
984944227 4:184958657-184958679 TGTCAGCCTCTCCCCAGGGATGG + Intergenic
985747004 5:1653379-1653401 GGCCAGCCGCTTCCCGGGGACGG - Intergenic
997592813 5:135086156-135086178 GGACATTCCCTCCCCGGGGCTGG - Intronic
1006188799 6:32195507-32195529 GGTGATCCCCGCTCCGGGGACGG + Exonic
1010465663 6:76165366-76165388 GGACAACCCCTAACCCGGGAGGG + Intergenic
1013155610 6:107489626-107489648 AGTCAACCCTCCCCGGGGGACGG + Intergenic
1017738060 6:157381443-157381465 CGGCAACCCCTCCCAGGGGTGGG - Exonic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019411982 7:910764-910786 GGTGCACCCCTCCCTGTGGAAGG - Intronic
1023044443 7:36198942-36198964 GGTCCACCCCTCCCTGTAGAGGG - Intronic
1023124266 7:36939679-36939701 GATCAACCCTTTCCCTGGGATGG + Intronic
1029110841 7:98212365-98212387 GGGCGTCCCCTCCCCGGGGGTGG - Exonic
1035319142 7:158017350-158017372 GCCCAGCCCCTCCCTGGGGAGGG + Intronic
1038263713 8:26020244-26020266 ACTCTATCCCTCCCCGGGGAAGG + Intronic
1041550669 8:59097154-59097176 GGTCAGAACCTTCCCGGGGATGG - Intronic
1042325961 8:67528228-67528250 AGGCAACCCCTCTCCTGGGAAGG - Intronic
1049224190 8:141441829-141441851 GGCCACCCCCTGCCCTGGGAAGG + Intergenic
1049404725 8:142447322-142447344 CCTCAGCCCCTCCCCAGGGAGGG - Intergenic
1054454729 9:65423983-65424005 GGACAAACCCTCCCTGGAGAAGG - Intergenic
1054818467 9:69498055-69498077 GGTAATCTCCTCCCTGGGGAGGG + Intronic
1060257716 9:122047255-122047277 GGTCAACCTTTTCCCGAGGATGG + Intronic
1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG + Intronic
1187249530 X:17584291-17584313 GGCCACCCCTTCCCTGGGGAGGG + Intronic
1189243272 X:39542026-39542048 GGCCATCGCCTCACCGGGGAAGG + Intergenic
1194608144 X:96006443-96006465 GGTCAATGCCTTCCCTGGGATGG + Intergenic