ID: 1061403591

View in Genome Browser
Species Human (GRCh38)
Location 9:130381814-130381836
Sequence TTGTGCTGAGCCCAGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061403591_1061403594 30 Left 1061403591 9:130381814-130381836 CCAAGGAGCTGGGCTCAGCACAA 0: 1
1: 1
2: 1
3: 25
4: 304
Right 1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061403591 Original CRISPR TTGTGCTGAGCCCAGCTCCT TGG (reversed) Intronic
900088305 1:908875-908897 TTCTGCTCAGCCCATTTCCTGGG + Intergenic
900533195 1:3164845-3164867 CTCTGCTGGCCCCAGCTCCTTGG + Intronic
901434957 1:9241737-9241759 TGGTCTTGAGCCCAGGTCCTTGG + Intronic
902720478 1:18300952-18300974 CCATGCTCAGCCCAGCTCCTGGG + Intronic
903461886 1:23526047-23526069 ATGTGAGGAGCCCTGCTCCTTGG + Intronic
903762542 1:25708977-25708999 TTTTCCTGAGCCCAGCCCCAGGG + Intronic
903763091 1:25712838-25712860 TTTTCCTGAGCCCAGCCCCAGGG - Intronic
903862691 1:26374445-26374467 CTGTCCTCAGCCCACCTCCTGGG - Intronic
904169076 1:28578743-28578765 TGGGACTGAGACCAGCTCCTAGG - Intergenic
904341808 1:29839990-29840012 TAGTGCTGACCCCAGCTTCAGGG + Intergenic
904525222 1:31128500-31128522 GTGTGCTAATCCCAGCTACTTGG - Intergenic
906775369 1:48524507-48524529 TCGTGCTGAGCACAGTCCCTGGG + Intergenic
906790118 1:48651929-48651951 ATGTGCTGATCCCTGCTGCTAGG + Intronic
906952847 1:50348716-50348738 TTTTGCTGAGATCAGCTCCGAGG - Intergenic
912488572 1:110048454-110048476 CAGCCCTGAGCCCAGCTCCTGGG + Intronic
914784714 1:150817931-150817953 CTGTCCTGAGCCCATCTCCAGGG + Exonic
915956561 1:160225035-160225057 GTGAGCAGGGCCCAGCTCCTAGG - Intronic
918130388 1:181622479-181622501 TTGTCCTGAGCCTCTCTCCTTGG + Intronic
919881640 1:201904853-201904875 TTCTGTTGAGCTGAGCTCCTCGG + Intronic
920293717 1:204942798-204942820 TGGTGCTGGGCCCAGCTTCTGGG + Intronic
921495152 1:215830288-215830310 TTCTGCTGGGCCCTGCTCCGAGG + Intronic
922698607 1:227744827-227744849 CTGTGCTGTGCCAAGCACCTGGG + Intronic
923141158 1:231162433-231162455 TGGTGCTGATCCCAGCCCCACGG + Intronic
923465765 1:234246937-234246959 CTGTGCTGTGCCTGGCTCCTAGG - Intronic
923964252 1:239119173-239119195 TTTAGCTGAGCTCAGGTCCTGGG + Intergenic
924804095 1:247348733-247348755 TTGTTATGGGCCCAGCTTCTGGG + Intergenic
1063093021 10:2884842-2884864 TTCAGCTAAACCCAGCTCCTGGG + Intergenic
1067038933 10:42938418-42938440 TTGCCCCCAGCCCAGCTCCTGGG + Intergenic
1070800230 10:79240908-79240930 TTTTGCTGAACTCAGCTCCTGGG + Intronic
1070907803 10:80089550-80089572 CTGTGATGATCCCAGCTACTTGG + Intronic
1071333452 10:84583404-84583426 TGCTGCTGTGCCAAGCTCCTTGG + Intergenic
1071457330 10:85861098-85861120 TGGTGCTGACCCCAGCTTCTGGG - Intronic
1073230011 10:101961179-101961201 TCGTGCTGAGCAAAGCTTCTGGG - Intronic
1073628343 10:105122049-105122071 CTCTGCTAAGCCCAGCTCCCTGG + Intronic
1074769486 10:116724062-116724084 TTGTACAGAGCCCTGCACCTGGG + Intronic
1075392025 10:122099056-122099078 CTGTGCTGAGCACATCTCATGGG + Intronic
1075641220 10:124065887-124065909 TTGTCCTGAGCTCAGTACCTGGG - Intronic
1076765693 10:132631695-132631717 TCGTGCTGGGCCCCGCTCCGCGG + Intronic
1078773397 11:14372065-14372087 TTGAGCTCAGCCCATATCCTAGG + Intergenic
1083449843 11:62736174-62736196 TTGCGGTGAGCCGAGATCCTGGG + Intronic
1085689326 11:78652584-78652606 ACGTGCTAAGCCCAGCTCCCTGG - Intergenic
1085816083 11:79738879-79738901 TTGTGGTCACCCCAGCTACTAGG + Intergenic
1086412729 11:86558561-86558583 TGCTGCTGAGCTCTGCTCCTAGG + Intronic
1088797033 11:113273272-113273294 TTGGGCTGAGGACAGCCCCTTGG - Intronic
1090190986 11:124767841-124767863 TTATGCTGAGATCAGCTCCCAGG - Exonic
1090291289 11:125547336-125547358 TTGTGATCAGCCCAGCTCCATGG - Intergenic
1090714709 11:129420039-129420061 TTGTGCTCATCCCAGCACTTTGG - Intronic
1090920015 11:131198957-131198979 CACAGCTGAGCCCAGCTCCTAGG + Intergenic
1091425684 12:387046-387068 TTGTTCAAAGCCCAGCTTCTGGG + Intronic
1092397812 12:8143915-8143937 TGCTGCTGTGCCCTGCTCCTAGG + Intronic
1092578709 12:9816857-9816879 TGGTGTTGGGCCCAGCTACTTGG - Intergenic
1092777741 12:11959098-11959120 TTGTACTGAGTCCCGCGCCTGGG + Intergenic
1094609470 12:31979505-31979527 ATGTGATGAGCCGAGCTTCTGGG - Intronic
1096548721 12:52358581-52358603 TTTTGCTCAGCCCAGATCCATGG + Intergenic
1102466395 12:113133143-113133165 TAGTGCTGAGCTCGGCTCCCAGG - Intronic
1102679276 12:114679761-114679783 TTGTACCGAGCCCACCTCCTTGG + Intronic
1102935158 12:116890377-116890399 GTGTGCTGATCCCTGCTCCAGGG + Intergenic
1103022921 12:117550852-117550874 TTTAGCTCAGTCCAGCTCCTTGG - Intronic
1103356860 12:120328036-120328058 TTGTACTCAGCCCAGCTTCACGG + Intergenic
1104857899 12:131910406-131910428 TTGAGCTGCGGCCAGCTCCCAGG + Intronic
1104915665 12:132263125-132263147 CTTGGCTGTGCCCAGCTCCTCGG - Intronic
1104953770 12:132454048-132454070 CTGTGCTCTGCCCAGCCCCTGGG - Intergenic
1106938310 13:34748190-34748212 TTGGGCTGAGCCAAGTGCCTTGG + Intergenic
1113610971 13:111644966-111644988 CTGTGCTGGGCCCAGTTCCCTGG - Intronic
1114039734 14:18666312-18666334 CTGTGATGATCCCAGCTACTTGG + Intergenic
1114044775 14:18864864-18864886 CTGTGATGATCCCAGCTACTTGG + Intergenic
1114119448 14:19654661-19654683 CTGTGATGATCCCAGCTACTTGG - Intergenic
1117659131 14:57986061-57986083 TGTTGCTCAGCACAGCTCCTGGG - Intergenic
1117882899 14:60329052-60329074 ATGTGCTAAGCCCAGGTGCTTGG + Intergenic
1118457419 14:65957690-65957712 GTGTGCTGACGGCAGCTCCTGGG - Exonic
1118603568 14:67487244-67487266 TGGTGCTGAGCCCAGAGCCCAGG - Intronic
1118775382 14:68970629-68970651 TGGTGCTGACCCCAGCTTTTGGG - Intronic
1119148096 14:72334285-72334307 CTGTGCTTGGCCCAGCTCCCAGG - Intronic
1121270308 14:92633242-92633264 AGGTGCTGAGCACAGCACCTTGG - Intronic
1121521268 14:94587602-94587624 TTGTGCTGGACCCAGCCCCCAGG - Exonic
1122228938 14:100295490-100295512 TTGGGCTCAGCACAGGTCCTGGG - Intronic
1124638920 15:31382921-31382943 GTGTCCTGACCCCAGCTCCAGGG + Intronic
1125679887 15:41523947-41523969 TTCTGCTGAGGCCAGCCTCTCGG - Exonic
1126952695 15:53899623-53899645 TTGCGGTGAGCCGAGATCCTGGG - Intergenic
1128058372 15:64717829-64717851 TTGTGAGGAGCCCTGCCCCTTGG + Intergenic
1128506436 15:68276426-68276448 TTGAGCCGAGCCCAGTCCCTTGG + Intergenic
1129926261 15:79367068-79367090 TTCTCCTGACCCCAGCTGCTGGG + Intronic
1130100935 15:80893568-80893590 TTAAGGTAAGCCCAGCTCCTCGG - Intronic
1130968957 15:88717670-88717692 TGCTGCTGAGGCCAGCTGCTGGG - Intergenic
1131098435 15:89670317-89670339 GTGGCCTGAGCCCAGCTCCCAGG + Intronic
1132791798 16:1694348-1694370 TTGTTCTGAGCGCAGCTCTGTGG - Intronic
1135119746 16:19755575-19755597 TTATGTGGAGCTCAGCTCCTTGG - Intronic
1136575605 16:31122818-31122840 TTGTAGTGAGCCGAGATCCTGGG + Intronic
1137021074 16:35428221-35428243 TATTGCTGGGCCCAGCACCTAGG - Intergenic
1137385567 16:48039455-48039477 TTCTGCTGAGACCAGCACCAAGG + Intergenic
1137604447 16:49778328-49778350 CTCTGCAGGGCCCAGCTCCTGGG - Intronic
1137731492 16:50693665-50693687 GAGTGCTGTGCCCAGCGCCTGGG + Intronic
1137922199 16:52501532-52501554 TGGTGGTGATCCCAGCTACTAGG + Intronic
1138571590 16:57877468-57877490 TTGTGGTGCTCCCAGCTACTAGG - Intergenic
1141103590 16:81215356-81215378 TTGTGCTGAGCCAGGTTCCCTGG + Intergenic
1141341998 16:83212145-83212167 TTATGCTGTGCTCAACTCCTGGG - Intronic
1141643973 16:85357572-85357594 CTGTGCTGGCCTCAGCTCCTGGG - Exonic
1144866825 17:18341023-18341045 TTGTAGTGAGCCCTGCTGCTGGG + Intronic
1145889849 17:28406656-28406678 GTGGGCTGAGCCCAGCTGCCTGG + Intronic
1146056448 17:29583738-29583760 TAGTGATGGTCCCAGCTCCTAGG - Intronic
1147973265 17:44231828-44231850 TGGTGGTGCGCCCAGCTACTTGG - Intergenic
1151704112 17:75757749-75757771 TTGTGCTGCTCCCAGCTCTTTGG - Exonic
1151823907 17:76512930-76512952 TGTTGATGAGCCCAGCTCTTTGG + Intergenic
1152584447 17:81182749-81182771 TTGTCCTGGGCCCAGCTGCTTGG - Intergenic
1152708566 17:81858849-81858871 TTGTGCTGCCCCCTGTTCCTAGG - Intronic
1152721324 17:81925117-81925139 TTCTCCTCAGTCCAGCTCCTGGG - Intronic
1155251732 18:23959391-23959413 TTCTGCCTAGCCCAGCTCCCAGG + Intergenic
1156194678 18:34760679-34760701 CTGAGCTGTGCCCAGCTGCTTGG - Intronic
1156516706 18:37686213-37686235 CCCTGATGAGCCCAGCTCCTGGG - Intergenic
1159005314 18:63005365-63005387 CTATGCTCAGGCCAGCTCCTCGG - Intergenic
1160152975 18:76408873-76408895 GTGTCCTGAGCCCAGCTTCATGG - Intronic
1160502702 18:79410274-79410296 GTTTGCTGAGGCCCGCTCCTTGG + Intronic
1162806337 19:13139655-13139677 GTTGGCTGGGCCCAGCTCCTGGG + Exonic
1163057160 19:14728907-14728929 TTGTGCCGACCCCAGCCCATGGG - Intronic
1163190270 19:15672441-15672463 CTAAGCTGAGCCCAGCTTCTAGG + Intergenic
1163442854 19:17330280-17330302 TTGGGCTGAGCCCTGCAGCTGGG - Intronic
1164206761 19:23065556-23065578 TAGTGCTGAGCTCAGCACCCAGG - Intergenic
1164257790 19:23544393-23544415 TAAAGCTGAGCCCAGCACCTAGG - Intronic
1164260294 19:23563536-23563558 TAGTGCTGAGCTCAGCACCCAGG - Intronic
1164282698 19:23782793-23782815 TAAAGCTGAGCCCAGCACCTAGG + Intronic
1164293662 19:23889818-23889840 TTTAGCTGAGCCCAGCACCCAGG + Intergenic
1164303894 19:23986601-23986623 TAGAGCTGAGCCCAGCTTCTAGG - Intergenic
1164313191 19:24064233-24064255 TAAAGCTGAGCCCAGCTCCTAGG + Intronic
1164314121 19:24071748-24071770 TATTGCTGGGCCCAGCACCTTGG + Intronic
1165231564 19:34390488-34390510 CTGTACTTAGCCCACCTCCTTGG - Intronic
1165335846 19:35169116-35169138 TGAGGATGAGCCCAGCTCCTGGG + Intronic
1167107476 19:47438713-47438735 TTGTGCTGAGGTCAGATCCAGGG - Intronic
1168158637 19:54493207-54493229 CTGTCCTGAGCCCAGCCCTTCGG - Intergenic
1168158655 19:54493279-54493301 CTGTCCTGAGCCCAGCCCTTTGG - Intergenic
925134937 2:1520243-1520265 TTGTGTTGAGCCCATTTGCTGGG - Intronic
926081558 2:9990752-9990774 GTGTCCTGACCCCAGCTCCCAGG + Intronic
926213597 2:10889877-10889899 TTGAGCTGAGCCCACCTGCCTGG - Intergenic
926372922 2:12198503-12198525 TTGAGTGGACCCCAGCTCCTGGG + Intergenic
926744015 2:16135835-16135857 TTGAGCTGAGGAGAGCTCCTGGG - Intergenic
927858484 2:26542684-26542706 CTGTCCTGTGTCCAGCTCCTTGG - Intronic
928052689 2:28016479-28016501 GTGTGCTCAGCCCAGCACCATGG - Intronic
928176494 2:29037601-29037623 CTGGCCTGAGCCCAGCTCCCTGG + Intronic
928190777 2:29165172-29165194 CTGGGCTGAGTCCAGCTCCTTGG - Intronic
929950231 2:46404435-46404457 TTTTGCTGCGCACATCTCCTGGG - Intergenic
931127974 2:59298604-59298626 TTGTGCTGAGACCATTTTCTGGG - Intergenic
933665075 2:84958247-84958269 TTGTGCTGATTCAAGCTCTTTGG + Intergenic
934950298 2:98571298-98571320 CTGGGCTTGGCCCAGCTCCTGGG - Intronic
935602766 2:104939747-104939769 TGGTGCTGAGTCCAGATCCTTGG - Intergenic
937839468 2:126511138-126511160 TGGTGCAGGGCCCAGCTCCCAGG + Intergenic
937873871 2:126805431-126805453 CTGTGCTTAGCCCAGCTAGTTGG + Intergenic
938248349 2:129796013-129796035 TTGAGCAGAGCCCAGCTCTCTGG + Intergenic
938270825 2:129969290-129969312 CTGTGATGATCCCAGCTACTTGG - Intergenic
938930474 2:136082281-136082303 TAATGCTGAGCCCAGCGGCTGGG - Intergenic
938941737 2:136175691-136175713 CAGAGCTCAGCCCAGCTCCTGGG + Intergenic
943957431 2:194210223-194210245 TTGTGTTTAGCACAGCTCTTGGG - Intergenic
945242441 2:207688305-207688327 TTGAGGTGATCCCAGCTACTTGG - Intergenic
947843053 2:233220977-233220999 TTGTTCTGTGCCAAGCACCTGGG - Intronic
947979625 2:234397939-234397961 CTGTGCTGCTCCCAACTCCTGGG - Intergenic
948465904 2:238151500-238151522 TGGTGCTGATCCCATCTCCGGGG - Exonic
1171344970 20:24459216-24459238 CAGTGCTGAGCCCAGATCATGGG + Intergenic
1172840320 20:37899022-37899044 TACTGCTGAGCCAAGCTCCCTGG - Intergenic
1173231000 20:41198128-41198150 TGGTGCTAATCCCAGCTACTTGG - Intronic
1173419847 20:42891262-42891284 CTCAGCTGAGCCCAGCTCCTGGG - Intronic
1173903089 20:46605296-46605318 TGGTGCTGAGCAGAGCTCTTAGG + Intronic
1174285930 20:49473532-49473554 TTCTCCTGGGCCCACCTCCTAGG - Intronic
1174561107 20:51431463-51431485 CTGTGGTGAGCCCAGCTGATGGG - Intronic
1175300499 20:57939517-57939539 TTGTGCAGATCCCAAATCCTAGG + Intergenic
1175738495 20:61404078-61404100 TTGCCCAGTGCCCAGCTCCTGGG - Intronic
1175915310 20:62423296-62423318 CTGGGTTGTGCCCAGCTCCTGGG + Intronic
1176135525 20:63520578-63520600 TTGGGCTGAGCCCAGCCCTGCGG - Intergenic
1176430583 21:6573277-6573299 GTGGGCTGAGCCCAGGTACTTGG + Intergenic
1177732330 21:25043713-25043735 TTCTGCTGAGTCCCTCTCCTTGG + Intergenic
1179400395 21:41077441-41077463 TTCTCCTGAGCCCCCCTCCTTGG + Intergenic
1179705977 21:43180739-43180761 GTGGGCTGAGCCCAGGTACTTGG + Intergenic
1179886381 21:44315954-44315976 GTGTGCTGGGCCCAGCCCCGAGG + Intronic
1180463298 22:15587421-15587443 CTGTGATGATCCCAGCTACTTGG + Intergenic
1180948542 22:19709967-19709989 GTGTGCTCAGCCCAGCTCAGGGG - Intergenic
1181163822 22:20973220-20973242 GGGTGCAGAGGCCAGCTCCTCGG - Intronic
1181409999 22:22712125-22712147 TTGTGCCCAGCCTTGCTCCTTGG - Intergenic
1182024472 22:27107168-27107190 CTGTGCTGTGCCAAGCTCCCAGG - Intergenic
1182215036 22:28708825-28708847 TGGTGGTGTGCCCAGCTACTCGG + Intronic
1183590521 22:38776947-38776969 GGGTGCTGACACCAGCTCCTCGG - Intronic
1184341994 22:43891270-43891292 TTCTGCTGCTCCCACCTCCTGGG - Exonic
1184368100 22:44065235-44065257 TGGTGCTGAGGGCAGCTTCTGGG + Intronic
1184434695 22:44463328-44463350 TGCTGATGACCCCAGCTCCTGGG - Intergenic
953615584 3:44488011-44488033 TCGTGGTGATCCCAGCTACTCGG + Intergenic
953620640 3:44529734-44529756 GTTTGCTGACCCCATCTCCTTGG - Intergenic
954215478 3:49122068-49122090 TCATCCTCAGCCCAGCTCCTGGG + Exonic
954798213 3:53172228-53172250 TCTTGCTGAGCCCACTTCCTGGG + Intronic
957218453 3:77351490-77351512 TTTTGCCGATCCCAGTTCCTGGG - Intronic
958673226 3:97231775-97231797 TTCTTCTGAGGGCAGCTCCTAGG - Intronic
958895624 3:99826062-99826084 TTGTGCTGGGCCGGGCTCCGTGG - Intronic
960943462 3:122949805-122949827 TTGTGCTGAGTTCAGTTCCTGGG - Intronic
961689988 3:128662406-128662428 GTGTGCTGAGACCAGCTCGGTGG + Intronic
962405723 3:135098134-135098156 CTATGCTCAGCTCAGCTCCTTGG + Intronic
963582745 3:147147341-147147363 TTGTGTTGAGGACAGCTCCAGGG + Intergenic
964297278 3:155247432-155247454 TTGTGCAGAGATCAGCACCTCGG - Intergenic
969316972 4:6388237-6388259 CTGTGCTGTGCCCAGCACCAGGG - Intronic
969397201 4:6929828-6929850 CTGTTCTGAGCTCAGCTTCTGGG + Intronic
969633427 4:8351565-8351587 GTTTCCTGGGCCCAGCTCCTAGG + Intergenic
969869696 4:10096949-10096971 TTGTGCTGAGACTGGCTGCTGGG + Intronic
970596854 4:17608699-17608721 GTCAGCTGAGCCCAGCTACTGGG + Intergenic
970768721 4:19584109-19584131 TTGGGTGGAGCCCAGCTCCTTGG - Intergenic
971181150 4:24329518-24329540 TTGTGCTGCGCCCTCCCCCTGGG + Intergenic
976418217 4:84804289-84804311 TTATGCTGAGACCAACTCATTGG - Intronic
977719617 4:100224154-100224176 CTGTGCTGTGCCCTGCTGCTGGG + Intergenic
977962175 4:103098511-103098533 TTGTGCTGAGGCCACCTTCTCGG + Intronic
983989980 4:174106799-174106821 TTGGGCTGACCGCAGCTACTGGG + Intergenic
984834964 4:184010890-184010912 TGGTGCCGAGCCCAGCAGCTTGG + Exonic
985536157 5:466801-466823 CTGTGCTGGGCCCTGCTCCAGGG - Exonic
988745124 5:34128060-34128082 TTGGGTTGGGCCCAGGTCCTCGG + Intergenic
989625667 5:43427273-43427295 TTGTGCTGAGCACAGCCCTAGGG + Intergenic
990449920 5:55924537-55924559 TTTTGCCCTGCCCAGCTCCTGGG - Intergenic
990506905 5:56454385-56454407 TGATGCTGAGCCCAGCATCTTGG - Intergenic
991432454 5:66562502-66562524 TTGTCCTAAGCCCAGTTCATAGG - Intergenic
994750058 5:103726486-103726508 TTGTGCAGAGCACATCCCCTTGG - Intergenic
996313921 5:122140033-122140055 CTGTGGTTAGCCCAGCTTCTAGG - Intronic
997831330 5:137153094-137153116 TATTGCTGAGCCCAGGTCCATGG + Intronic
999626844 5:153530076-153530098 TTGTGCTGTGCCCAGCTCTGCGG + Intronic
999627937 5:153540030-153540052 CTGTGCTGAGGCCAGGTGCTTGG + Intronic
1000539387 5:162520940-162520962 TTGAGCTCAGCACAGCACCTGGG + Intergenic
1002581266 5:180210705-180210727 ATGGCCTGAGCTCAGCTCCTCGG - Intergenic
1003216432 6:4117620-4117642 GTGTGCTGAGACAGGCTCCTGGG + Intronic
1005543246 6:26835814-26835836 TTGGGTTGGGCCCAGGTCCTCGG + Intergenic
1006437714 6:34034925-34034947 TTGGGGTGTGCCCAGGTCCTCGG + Intronic
1007307893 6:40921446-40921468 CTGTGCTGAGCAGAGCCCCTTGG + Intergenic
1007419914 6:41713147-41713169 CTGTGCTGAGCCCAGGGCCCTGG - Intronic
1007461401 6:42021808-42021830 GTGAGTTGAGCCCAGATCCTAGG + Intronic
1007973193 6:46073803-46073825 TTCTGCTGAGCCCACTGCCTGGG + Intronic
1008457694 6:51729949-51729971 TTGCACTGAGTCCAGCTGCTTGG - Intronic
1008941141 6:57046895-57046917 TTGGGCCGAGCCCAGCTCTGGGG + Intronic
1008945330 6:57090393-57090415 TTGGGCCGAGCCCAGCTCTGGGG + Intronic
1009014073 6:57877979-57878001 TTGGGTTGGGCCCAGGTCCTCGG + Intergenic
1011685654 6:89821416-89821438 TTGTGGTGAGCCGAGATCGTGGG + Intergenic
1014156171 6:118112252-118112274 TTGTTCTCATCCCAGCTACTTGG - Intronic
1015869453 6:137761132-137761154 GACTGGTGAGCCCAGCTCCTGGG - Intergenic
1015966531 6:138699620-138699642 TGATGCTGGGCTCAGCTCCTGGG - Intergenic
1016362261 6:143279954-143279976 TTGTTTTTAGCTCAGCTCCTGGG + Intronic
1017401874 6:154073864-154073886 TGGTGGTGATCCCAGCTACTCGG + Intronic
1018371512 6:163172660-163172682 GTGTCCTGAGCCCAGCTCCCTGG - Intronic
1018551573 6:165004412-165004434 TTGGGCTGACCCCAGCCCCGTGG + Intergenic
1018757800 6:166864571-166864593 TTGAGGGAAGCCCAGCTCCTGGG + Intronic
1018959136 6:168434228-168434250 TTCTGCAGAGGCCAGCTCCAGGG - Intergenic
1019025841 6:168962360-168962382 TTGTGCTGAGTCCATCTCTGTGG - Intergenic
1019334582 7:476941-476963 CAGTGCTGAGCCCAGCACCGTGG - Intergenic
1019451562 7:1101311-1101333 TGCTGCTGAGCCCAGGTACTGGG + Intronic
1020023439 7:4882979-4883001 AGATGCTGAGCCGAGCTCCTGGG - Intronic
1022502262 7:30889333-30889355 TTGTGCTGACCCCAGCTCCTGGG - Intronic
1022942025 7:35250164-35250186 TCGTCCTGTGCCCAGCCCCTGGG - Exonic
1023529610 7:41138563-41138585 TTCTCCTGACCCCAGATCCTAGG + Intergenic
1023538239 7:41236825-41236847 CTGGGCTGAGCAGAGCTCCTGGG - Intergenic
1024028629 7:45436034-45436056 TGATGCTGAGCCCAGCATCTGGG - Intergenic
1024070832 7:45783870-45783892 TCATGCTGACCCCAGCTCCCTGG - Intergenic
1024685369 7:51738703-51738725 TGCTGCTGAACCCAGCTGCTGGG + Intergenic
1024782297 7:52865270-52865292 CTGTGCTGTGCCCTGCTACTGGG - Intergenic
1024811701 7:53219450-53219472 TCCTGCTAAGCCCAGCTCCCCGG + Intergenic
1025156914 7:56615230-56615252 TATTGCTGAGCCCAGCAGCTAGG - Intergenic
1025223889 7:57139966-57139988 TATTGCTGAGCCCAGTACCTAGG + Intergenic
1027148612 7:75716351-75716373 GTGTGCTAATCCCAGCTACTTGG - Intronic
1029336869 7:99908374-99908396 GTATGCTGAGCTCAGCTCATAGG - Intronic
1032205770 7:129863928-129863950 TTGTGGTAATCCCAGCTACTTGG - Intronic
1032474290 7:132201887-132201909 TTGCTCTGGGCCCAGCTCATGGG - Intronic
1032506930 7:132442665-132442687 TCGTGCTTAGCCCAGGGCCTGGG - Intronic
1032676784 7:134136903-134136925 TTTTGGAGAGCTCAGCTCCTGGG + Intronic
1035311234 7:157970347-157970369 TTCTGCTGAGCAGAGCACCTGGG - Intronic
1035430245 7:158814744-158814766 ATGGGCTGGGCCCAGCTCCCAGG + Intronic
1035932866 8:3803516-3803538 CTGTCCTGGGCCCAGCCCCTGGG - Intronic
1040375503 8:46820932-46820954 TATTGCTGAGCCCATCACCTAGG + Intergenic
1040377393 8:46839574-46839596 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1040377914 8:46844350-46844372 TATTGTTGAGCCCAGCACCTAGG + Intergenic
1040378323 8:46848003-46848025 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1040380098 8:46864276-46864298 TATTGTTGAGCCCAGCACCTAGG + Intergenic
1041477163 8:58279191-58279213 TTCGGCTGAGCCCTGCTCCCAGG - Intergenic
1042544850 8:69942268-69942290 TGTTGCTGAGCCCAGCTCCCAGG - Intergenic
1045041643 8:98230204-98230226 TTGTGCTCTGTACAGCTCCTAGG - Intronic
1045271391 8:100664742-100664764 ATGTGCTTAGCTCAGCACCTGGG - Intergenic
1045493787 8:102690856-102690878 TGGTGTTGATCCCAGCTCCATGG + Intergenic
1045500455 8:102740604-102740626 CTGTGCTCAGCTCAGCCCCTGGG + Intergenic
1046152031 8:110240053-110240075 GTGTGCTGAACCCAGTTCATTGG + Intergenic
1047258216 8:123232851-123232873 TAGTACAGAGCACAGCTCCTCGG + Intronic
1049602565 8:143514704-143514726 AGGCGGTGAGCCCAGCTCCTGGG - Intronic
1051441892 9:17093570-17093592 TTGTGCTGGTCACAGATCCTCGG - Intergenic
1051754791 9:20387311-20387333 TTTTGCTGATCCCTGCTCCATGG + Intronic
1052713619 9:32088507-32088529 ATGTGATGAGAGCAGCTCCTTGG - Intergenic
1052743667 9:32418261-32418283 TTCTACTCAGCCCATCTCCTTGG - Intronic
1052840475 9:33288517-33288539 GTTGGCTGGGCCCAGCTCCTGGG + Intergenic
1052990825 9:34518568-34518590 CTTTGCTGAGCCCAGCTAGTTGG + Intronic
1057949987 9:99362078-99362100 TTGTGCTGAGACCAGAGCCAGGG + Intergenic
1058814337 9:108669449-108669471 TTGTGGTGACCCCAGCACCAGGG - Intergenic
1059686760 9:116645258-116645280 TTGTGCTGAGCCAAGCTCTGTGG + Intronic
1061403591 9:130381814-130381836 TTGTGCTGAGCCCAGCTCCTTGG - Intronic
1061512759 9:131071032-131071054 TTGTGCTGAGACTGGCTCCTAGG + Intronic
1061843155 9:133371839-133371861 TAGGGCCGAGGCCAGCTCCTAGG + Intronic
1062379690 9:136281260-136281282 CTGTGCCCAGCCCACCTCCTAGG - Intergenic
1185653516 X:1666415-1666437 TTCTGCTTCTCCCAGCTCCTGGG + Intergenic
1187972512 X:24673232-24673254 TGGTGCTGAGAATAGCTCCTTGG - Intergenic
1190285640 X:48959358-48959380 TGGTGCTGTGCCCAGCACATAGG + Intergenic
1190726268 X:53192776-53192798 TTGTTCAGACCTCAGCTCCTGGG - Exonic
1192550231 X:72047742-72047764 TTGTGCCAAGGCCAGCTCCTAGG + Intergenic
1199754808 X:150854152-150854174 TAGTCCTGAGCCCAGAGCCTGGG + Intronic
1200059377 X:153477391-153477413 CTGAGCTGAGCCTAGCACCTGGG - Intronic
1200091114 X:153636492-153636514 TGGTGCTGAGGCTGGCTCCTTGG - Intergenic
1200097884 X:153672649-153672671 GTGTGCGGAGCCCCGCTCCTGGG + Exonic
1200301752 X:154983597-154983619 TTGTGCTGAGCTCAAGTGCTGGG + Intronic
1200854866 Y:7926590-7926612 TGTTGCTGAGCCCAGCATCTAGG - Intergenic
1200856778 Y:7947426-7947448 TTTTGCAGAGCCCAGCTCCTAGG - Intergenic
1200858686 Y:7966655-7966677 TATTGCTGAGCCCATCACCTAGG - Intergenic
1200859762 Y:7978083-7978105 TATTGCTGAGCCCAGCACCTAGG - Intergenic
1200862962 Y:8012597-8012619 TATTGCAGAGCCCAGCACCTAGG - Intergenic
1200867343 Y:8059069-8059091 TATTGCTGAGCCCAGCACCAAGG + Intergenic
1200869574 Y:8082933-8082955 TATTGCTGAGCCCAGCACCCAGG - Intergenic
1200889816 Y:8311578-8311600 TATTGCTGAGCCCAGCACCTAGG + Intergenic
1200896471 Y:8381151-8381173 TAATGCTGAGCCCAGGACCTAGG - Intergenic
1200904275 Y:8465394-8465416 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1200906709 Y:8490996-8491018 TATTGCTGAGCCCAGCACCTAGG + Intergenic
1200907686 Y:8501268-8501290 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1201256659 Y:12114193-12114215 TTCTCCTGAGACCTGCTCCTTGG - Intergenic
1201397782 Y:13567318-13567340 TTGTCCTGAGCCAAGGTCCCAGG + Intergenic
1202071523 Y:20996631-20996653 TGGTCCTGAGCCAAGATCCTGGG - Intergenic
1202080997 Y:21084114-21084136 TACGGCTGAGCCCAGCACCTAGG + Intergenic
1202143040 Y:21748905-21748927 TTGTTCTGGGCCCAGCTTTTTGG + Intergenic
1202143787 Y:21756910-21756932 TTGTTCTGGGCCCAGCTTTTTGG - Intergenic
1202253437 Y:22895968-22895990 TATTGCTGAGCCCAGCACCCAGG - Intergenic
1202259498 Y:22955534-22955556 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1202260521 Y:22965670-22965692 TATTGCTGAGCTCAGCACCTAGG + Intergenic
1202262676 Y:22985928-22985950 TATTGCTGAGCCCAGCACCCAGG + Intronic
1202263146 Y:22990763-22990785 TATTGCTGAGCCCATCACCTAGG + Intronic
1202406427 Y:24529717-24529739 TATTGCTGAGCCCAGCACCCAGG - Intergenic
1202412484 Y:24589278-24589300 TATTGCAGAGCCCAGCACCTAGG + Intergenic
1202413508 Y:24599411-24599433 TATTGCTGAGCTCAGCACCTAGG + Intergenic
1202415666 Y:24619669-24619691 TATTGCTGAGCCCAGCACCCAGG + Intronic
1202416136 Y:24624504-24624526 TATTGCTGAGCCCATCACCTAGG + Intronic
1202454651 Y:25045582-25045604 TATTGCTGAGCCCATCACCTAGG - Intronic
1202455121 Y:25050417-25050439 TATTGCTGAGCCCAGCACCCAGG - Intronic
1202457274 Y:25070657-25070679 TATTGCTGAGCTCAGCACCTAGG - Intergenic
1202458296 Y:25080792-25080814 TATTGCAGAGCCCAGCACCTAGG - Intergenic
1202464355 Y:25140364-25140386 TATTGCTGAGCCCAGCACCCAGG + Intergenic