ID: 1061403592

View in Genome Browser
Species Human (GRCh38)
Location 9:130381850-130381872
Sequence GGGGTGACAGCAGTGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061403592_1061403594 -6 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC 0: 1
1: 0
2: 3
3: 32
4: 261
Right 1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG No data
1061403592_1061403602 20 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC 0: 1
1: 0
2: 3
3: 32
4: 261
Right 1061403602 9:130381893-130381915 AGGTTTGCCATCTGTAAGATGGG No data
1061403592_1061403599 0 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC 0: 1
1: 0
2: 3
3: 32
4: 261
Right 1061403599 9:130381873-130381895 CAGCACTGCCATGAAGGCTCAGG No data
1061403592_1061403601 19 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC 0: 1
1: 0
2: 3
3: 32
4: 261
Right 1061403601 9:130381892-130381914 CAGGTTTGCCATCTGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061403592 Original CRISPR GGGGTGACAGCAGTGGTTGC TGG (reversed) Intronic
900819110 1:4872576-4872598 GGGGTGACAGCACTGTTTGAAGG - Intergenic
901041871 1:6368846-6368868 GTGGTGCAAGCAGTGGTGGCAGG - Intronic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
901676174 1:10886932-10886954 GGAGTGACAGCTGTGGTCACAGG + Intergenic
903395995 1:23002272-23002294 GGGGCTACAGGAGTGGCTGCTGG + Intergenic
903957569 1:27035783-27035805 TGGGGGGCAGCAGAGGTTGCTGG + Intergenic
904035105 1:27554746-27554768 GGGGTGACAGCATGGGTAGGTGG - Intronic
904083378 1:27886203-27886225 GGTGGGACAGCTGGGGTTGCAGG - Exonic
905613122 1:39372733-39372755 GGGGTGACAGGTCAGGTTGCAGG - Intronic
906362624 1:45176732-45176754 GGGGTGGCAGCAGTAGGTGCAGG - Intronic
906791228 1:48660217-48660239 GGGGTGGCAGCAAGGGTAGCAGG - Intronic
907115082 1:51961112-51961134 AGGGTGAAAGGAGTGGTTGGGGG - Intronic
907849778 1:58245154-58245176 GGGATGACAGCACTGTTTTCTGG - Intronic
911257230 1:95646543-95646565 TGGGTGACAACAGAGGTGGCTGG + Intergenic
912687414 1:111778294-111778316 GGTGTGACAGCAGAGGTAGGAGG + Intronic
916676262 1:167066499-167066521 AGGGTGAGAGCAGGGGTTCCTGG - Intronic
919960847 1:202467175-202467197 GGGAGGACAGCATTGCTTGCAGG - Intronic
919971403 1:202581960-202581982 TGGGTGAAAGCTGTGGTAGCAGG - Exonic
920186694 1:204163760-204163782 GTGGTGAAGACAGTGGTTGCAGG + Intronic
921883227 1:220277105-220277127 GGGGTGAGAGCAGTGAGAGCAGG + Intergenic
922383909 1:225061520-225061542 GCAGTGTCAGCAGTGGGTGCAGG - Intronic
924570603 1:245234564-245234586 GGTGAGACAGCAGTGTTTCCTGG + Intronic
1067536215 10:47112163-47112185 CGGGTGACAGCGGTGGTGGGAGG - Intergenic
1068229588 10:54154788-54154810 GGGTGGACAGATGTGGTTGCTGG + Intronic
1069806494 10:71128483-71128505 GGGGCCACAGGACTGGTTGCTGG - Intergenic
1069842019 10:71345843-71345865 GGGGAGACAGCCGTGGTGGGGGG + Intronic
1070564095 10:77590526-77590548 GGGCTGCCAGCGGTGCTTGCGGG - Intronic
1070663551 10:78327858-78327880 GTGGTGGCAGCAGTGGTGGAGGG + Intergenic
1070955364 10:80459992-80460014 GGGGTGGGAGCAGTGGGTCCAGG + Intronic
1071524243 10:86349001-86349023 GTGGTGGCAGCAGTGGCTGCTGG + Intronic
1073609137 10:104926067-104926089 GTGCTGACCGCAGTGGCTGCTGG + Intronic
1075645208 10:124092447-124092469 GAGGGGACAGCAGTGGGGGCGGG + Intronic
1075764876 10:124885367-124885389 AAGGTGGCAGCAGTGGCTGCTGG + Intergenic
1075766723 10:124899156-124899178 AGGGGGACAGCAGTGGTGACTGG + Intergenic
1076776941 10:132703120-132703142 GGGGTGACCGCAGGGGAAGCTGG - Intronic
1079182993 11:18210055-18210077 GGCGTGGCAGCAGTGCTTGCAGG + Exonic
1082933692 11:58634864-58634886 GAGGAGACAGCAGTGATAGCAGG - Intergenic
1083169438 11:60914312-60914334 GGGGAGACAGCAGCCGCTGCAGG + Intronic
1084629463 11:70337223-70337245 GGGACTACAGCAGTGCTTGCTGG + Intronic
1085293731 11:75418461-75418483 TGGGTGGCAGCAGTGGTGGTAGG + Intronic
1087080742 11:94168798-94168820 AGGGTGACAGCAGTGGAGGTGGG + Intronic
1087145352 11:94805355-94805377 GGGCTGACAGCTGTGGGTGTGGG + Intronic
1088340894 11:108765225-108765247 GGTGTCACAGCAGTGGTAGTGGG + Intronic
1088993093 11:114971522-114971544 GGGGAGACAGTAGTGGTAGACGG - Intergenic
1089769589 11:120793690-120793712 GAGGTGAAGGCAGTGGTTACAGG + Intronic
1090205947 11:124884507-124884529 TGGAGGACAGCAGTGGCTGCTGG - Exonic
1091700338 12:2654868-2654890 GGGCTGAGAGCGGTGGATGCTGG - Intronic
1091888991 12:4038072-4038094 GGGGTGACAGCTGGAGTTGAAGG - Intergenic
1092390336 12:8071638-8071660 GGTGTGGCAGCAGTGGCTGCTGG + Intergenic
1092709046 12:11315062-11315084 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1094425714 12:30315180-30315202 GTGGTCACAGCAGTGGCTGAAGG - Intergenic
1098522636 12:71450973-71450995 GGATTGGCAGCAGGGGTTGCAGG - Intronic
1102037910 12:109782736-109782758 GGGGTGACAGTAGTGCTGGCTGG - Intergenic
1102576992 12:113861879-113861901 GAGGTCACAGCTGTGGTTGGGGG + Intronic
1103192898 12:119017555-119017577 GGGGTGGCAGGAGTGGGAGCAGG + Intronic
1103272098 12:119681858-119681880 GGGGTAACAGCAGAGGCTCCTGG + Intergenic
1103394979 12:120600411-120600433 GGGGTGGCAGGAGTGGCTGTGGG - Intergenic
1104016099 12:124963367-124963389 GGGGTGACTGCAGTGGTCACGGG + Intronic
1104661329 12:130613199-130613221 GAGTTGACAGCAGTGCTGGCGGG + Intronic
1105756258 13:23466859-23466881 CGGGTGACAGCAGGGCTCGCAGG - Intergenic
1107149240 13:37092396-37092418 GTGGTGGCAGGAGTGGCTGCAGG + Intergenic
1107627863 13:42308522-42308544 GTGATGACAGCACTGGTAGCTGG + Exonic
1108484771 13:50912403-50912425 GGGGTGGGGGCAGTGGTTTCCGG - Intronic
1111243116 13:85501786-85501808 GGGGCCACAGGAGTGGTTGGTGG - Intergenic
1112622344 13:101065347-101065369 AGGCTGACAGCTGTGGTTTCTGG + Intronic
1113570704 13:111354792-111354814 GGGGAAAAATCAGTGGTTGCAGG + Intergenic
1114131818 14:19800824-19800846 GGGGTGGCAGCAGTGGCAGATGG - Intronic
1116230431 14:42208685-42208707 GGAGTGACAGCGCAGGTTGCTGG + Intergenic
1118466085 14:66032467-66032489 GGAGTGCCAGCAGTGGGTGCAGG - Intergenic
1119475102 14:74922675-74922697 GGGATGACAGCCGTGGCTGCGGG + Intronic
1119659447 14:76439789-76439811 GGGGTGGCAGCCGTGCCTGCGGG + Intronic
1119724347 14:76913281-76913303 TGGGTGACAGCAGTGCTGTCAGG + Intergenic
1121480439 14:94265443-94265465 GGGGTGACAGAAGAGGGTCCAGG - Exonic
1122314887 14:100820128-100820150 GCGGTGGCAGCAGTGGTGGCAGG + Intergenic
1122314936 14:100820368-100820390 GTGGTGGCAGCAGTGGTGGTAGG + Intergenic
1122384330 14:101333702-101333724 GGGGTGCCAGCAGTGTGTGCTGG - Intergenic
1123574886 15:21656528-21656550 GGGGTGGCAGCAGTGGCAGAGGG - Intergenic
1123611501 15:22099017-22099039 GGGGTGGCAGCAGTGGCAGAGGG - Intergenic
1127901681 15:63345697-63345719 GGGGTGGCAGCAGGGGTGGAGGG - Intronic
1128788781 15:70417474-70417496 GTGGTGCCAGCATTGGTTCCAGG - Intergenic
1129321005 15:74774822-74774844 GGGGTGGCAGTGGAGGTTGCAGG + Intergenic
1129700879 15:77768185-77768207 GGGGTGGAGGCAGGGGTTGCTGG - Intronic
1130373375 15:83306171-83306193 GAGCTGACAGGAGTGCTTGCCGG + Intergenic
1130650859 15:85761356-85761378 GGCGTGAGAGCCGTGGTTGCAGG + Intronic
1132148519 15:99443190-99443212 GGGGGCACAGCAGTGGGTACTGG + Intergenic
1202983754 15_KI270727v1_random:390772-390794 GGGGTGGCAGCAGTGGCAGAGGG - Intergenic
1134537939 16:15041520-15041542 GCAGTGACAGCAGTGTGTGCCGG + Intronic
1135206770 16:20491662-20491684 GAGGTGCCAGCAGTGGTGGCAGG + Intergenic
1135212115 16:20531970-20531992 GAGGTGCCAGCAGTGGTGGCAGG - Intergenic
1137476870 16:48817021-48817043 GGGGTGAGACCCGTGGTGGCTGG + Intergenic
1138444562 16:57055276-57055298 GGGGTGGGAGCAGTGGATTCTGG + Intronic
1139651303 16:68363574-68363596 GGGGTGACAGTGGTCGCTGCAGG + Intronic
1139744731 16:69065191-69065213 GGAGTGGCAGCTGTGGTGGCAGG - Intronic
1142179156 16:88658878-88658900 GGGGTGGGAGCAGTTCTTGCAGG - Intronic
1142398259 16:89845252-89845274 GGGGGGACAGCAGTGTTTATTGG + Intronic
1142474361 17:180717-180739 GGGGAGACACCAGTTGCTGCCGG - Intronic
1142480056 17:213627-213649 GGGCTGAGGGCAGTGGTTGGAGG + Exonic
1143782992 17:9239276-9239298 CGGGTGAGAGCAGTGCTGGCGGG - Intronic
1144650672 17:17004956-17004978 GGGGTGGCAGCAGGGGAAGCAGG + Intergenic
1144679047 17:17180690-17180712 GGGGTGTGAGCAGTGCATGCAGG - Intronic
1145818892 17:27816143-27816165 GAGGTGACAGCAGTGACTTCTGG + Intronic
1146952828 17:36918679-36918701 GAGCTCACAGCAGTGTTTGCAGG + Intergenic
1147548361 17:41420534-41420556 GGGGAGACAGCACTTGGTGCAGG + Intergenic
1148245114 17:46025294-46025316 GGGGTGACTGCAGTGGCCGTGGG - Exonic
1148804403 17:50257120-50257142 TGGGGGACAGCAGGGGTTGCAGG + Intergenic
1149507637 17:57208140-57208162 GGGGTCACAGAACTGGTTCCAGG - Intergenic
1152643242 17:81457811-81457833 GGGGGGAGGGCAGGGGTTGCTGG + Intronic
1152643302 17:81457961-81457983 GGGGGGAGGGCAGGGGTTGCTGG + Intronic
1152902033 17:82947771-82947793 TGAGTGACAGCAGTGGTAGGTGG - Intronic
1153819886 18:8824171-8824193 GGGGTGCCAGCAATGCTTCCAGG - Intronic
1154201240 18:12302142-12302164 AGGGTGACAGCAGTGGGCACAGG - Intergenic
1154289498 18:13095008-13095030 GGGGTGACAGGGGTGGGTGGTGG - Intronic
1155936499 18:31760276-31760298 GGCGTGGCGGCAGTGCTTGCAGG - Exonic
1156214103 18:34978152-34978174 GAGGGGACAGCAGTGTTGGCTGG - Intronic
1160267617 18:77353842-77353864 GGGGTGAGACCTGTGGCTGCCGG - Intergenic
1160501713 18:79404559-79404581 GAGGTGACAGCAGTGCCTGGGGG + Intronic
1160505457 18:79423951-79423973 GGTGGGACAGCAGTGGTCCCAGG + Intronic
1160710927 19:550646-550668 GGGGTGACAGGACTGTTTTCAGG - Intergenic
1160917974 19:1506765-1506787 GGGGTGACAGCAGGGGCTGCGGG + Exonic
1161575024 19:5050419-5050441 TGGGTGACAGAAGGGGCTGCGGG - Intronic
1162920367 19:13898207-13898229 GGGGTGCCAGCCTTGGTTCCTGG - Intronic
1162938422 19:13993695-13993717 GGGGTGGCAGCAGCGGTGGGTGG + Exonic
1164896560 19:31882183-31882205 GGTGTGACTGCAGTGGTCACTGG + Intergenic
1165791704 19:38496572-38496594 GGGGTGCCAGGAGTGGGTTCTGG - Intronic
1165850007 19:38844353-38844375 GGTGTGGCAGAAGAGGTTGCTGG - Intronic
1167698361 19:51027769-51027791 GGGGTGACAGACCTGCTTGCAGG + Intronic
926150609 2:10423625-10423647 TGGGTGGCAGCAGTGGTGACAGG + Intronic
927465208 2:23331639-23331661 GGGGTGACGGCAGAGCGTGCAGG - Intergenic
927469501 2:23362454-23362476 GGGGAGAGAGCAGTGGTGCCAGG + Intergenic
928269197 2:29840983-29841005 GCGGTGACTGCAGTGTTTGATGG - Intronic
928279273 2:29929826-29929848 GGGGTGACAGCAGAGGACTCTGG - Intergenic
930072605 2:47379934-47379956 GTGGTGATAGCAGTTGTTGCTGG + Exonic
932522207 2:72426869-72426891 GAGGTGCAAGCAGTGGCTGCAGG + Intronic
932763952 2:74458523-74458545 GCGGTGGCAGCAGAGGTGGCAGG + Exonic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
937156402 2:119722761-119722783 GGGGTGAGTGCAGTGCTTGCCGG + Intergenic
937336172 2:121063635-121063657 AGGGTGACTGCTGCGGTTGCAGG - Intergenic
937916036 2:127099146-127099168 GGGGAGACAGCACTGATGGCTGG - Intronic
938809865 2:134843213-134843235 AGGGTGAGAGCAGGGGTTGAGGG + Intronic
939236775 2:139504273-139504295 GGTGTGACTCCAGTGGTTTCAGG + Intergenic
941780694 2:169441409-169441431 GTGGTGGCAGCAGAGGCTGCAGG + Intergenic
945907513 2:215611937-215611959 GGGGGGTCAGTAGTGGTTTCTGG - Intergenic
946147002 2:217738526-217738548 CAGGTGGCAGCAGAGGTTGCTGG + Intronic
947317430 2:228876550-228876572 GGGGAGTCAGCAGTGGTTGCTGG - Intronic
947939342 2:234035868-234035890 GCAGTGAGAGTAGTGGTTGCAGG - Intergenic
948151961 2:235751511-235751533 ACGGTGAAAGCAGTGGCTGCAGG + Intronic
948712846 2:239836098-239836120 GTGGTGGCAGGAGTGGCTGCAGG + Intergenic
948777211 2:240296028-240296050 GTGGTGTCTGCAGTGGTTCCAGG - Intergenic
1168870846 20:1126966-1126988 GTGGTGGCAGCAGTGGTTTCCGG - Intronic
1169191315 20:3660645-3660667 GGGGTGACGGCGGTGCCTGCGGG + Exonic
1169491270 20:6073210-6073232 GGGGTGACAGGAGTGGAAGGGGG + Intergenic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169950124 20:11034519-11034541 GGGGTGAAGGCAGTGGTTGGTGG + Intergenic
1170338634 20:15298673-15298695 GGGGTCACACCAATGGTTGTTGG + Intronic
1171489066 20:25503902-25503924 AGAGTGACAGCAGTGGTTGCTGG + Intronic
1172010870 20:31844986-31845008 GGCCTGCCATCAGTGGTTGCTGG + Exonic
1172386461 20:34537462-34537484 GGGGTGTCAGCAGTGGAGGGAGG - Intronic
1172889222 20:38252329-38252351 GGGGTGACAGTAGTGGACACAGG - Intronic
1172898940 20:38320236-38320258 AGGGTCTCAGCCGTGGTTGCTGG - Exonic
1174067101 20:47873433-47873455 GGTGTGACTGCAGTGGGTGCTGG + Intergenic
1174476926 20:50802253-50802275 GGGGGGACCGCAGTGGCAGCAGG + Intronic
1174593674 20:51666760-51666782 GGCGTGACTGCAGTGGGAGCAGG + Intronic
1175960181 20:62631866-62631888 GTGGTGGCAGGAGTGGCTGCAGG - Intergenic
1176040158 20:63060945-63060967 GGGGTGACCACAGTGGTTAGGGG + Intergenic
1179711769 21:43267643-43267665 GGGGTGGCAGCACTGGGTCCTGG + Intergenic
1180883965 22:19226520-19226542 GTGGTGGCAGCAGTGCTTGTGGG + Intronic
1181098144 22:20520203-20520225 TGGGTGAAAGCAGTGCTTGTAGG + Intronic
1181622486 22:24100589-24100611 GGGGCGTCAGCACTGATTGCAGG + Intronic
1182879079 22:33717899-33717921 GGGGTGACATGAGTGGTGACTGG - Intronic
1183544745 22:38449458-38449480 GGGGTGAGAGCAGTGTTCTCAGG - Intronic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
1184676212 22:46044839-46044861 GGGGTGACAGCAGCGCTTCGGGG + Intergenic
1185187529 22:49411276-49411298 GGGGGGACAGCAGTGGCAGTGGG - Intergenic
1185318541 22:50189731-50189753 GGGGTGGCTGCAGTGTGTGCTGG + Intronic
1185318557 22:50189789-50189811 GGGGTGGCTGCAGTGTGTGCTGG + Intronic
949309309 3:2678506-2678528 GCGGTGAAAGCAATGGTTGTGGG + Intronic
950443328 3:13022432-13022454 CAGGAGACAGCAGTGGCTGCAGG + Intronic
952905053 3:38134341-38134363 GGGGTGACAGCAGGGCTCACAGG - Intronic
953010330 3:39019268-39019290 GGGGTCACAGGAGTGGTTGGTGG - Intergenic
953348087 3:42192790-42192812 GGGGAGACAGCCTTGGTTGGTGG + Intronic
953998578 3:47538776-47538798 GGGTTCCCAGCAGTGGATGCGGG - Intergenic
954497811 3:50982441-50982463 GAGGTGCAAGCAGTGGTGGCAGG + Intronic
956815715 3:72906424-72906446 GGGGTGCCAGGAGTGGCTGGCGG - Intronic
958675716 3:97265757-97265779 GTGGTGGCAGGAGTGGCTGCAGG - Intronic
959665504 3:108916638-108916660 GGGGTGCCAGCGGTGGAAGCCGG - Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961040699 3:123676088-123676110 GGGGTGCCAGCATTGCTTGGTGG + Intronic
961650046 3:128412786-128412808 GCGGAGGCAGCAGTGGGTGCTGG + Intergenic
961942729 3:130654961-130654983 GGGGCCACAGGAGTGGTTGGTGG + Intronic
966781498 3:183588149-183588171 GGGGTGACAGCAGAGATGGCAGG + Intergenic
968085353 3:195871641-195871663 GGGGTTACAGCTGTGGCTCCGGG + Intronic
968467716 4:760883-760905 GGGGAGACAGCAGCGACTGCAGG - Intronic
968746822 4:2364710-2364732 GGGGTGACAGTGGTGGACGCAGG + Intronic
968872078 4:3247303-3247325 GGGGTCCCAGCAGTGGTTCTGGG - Intronic
969562612 4:7959294-7959316 GGGGTACCAGCAGAGGCTGCCGG - Intergenic
975254556 4:72217130-72217152 GTGGTGACAGGAGTGGCTGCAGG - Intergenic
975582772 4:75921725-75921747 GTGGTGAAAGTGGTGGTTGCAGG + Intronic
977898812 4:102395377-102395399 TGGGTGACAGCACGGGTGGCTGG - Intronic
979322546 4:119341394-119341416 GTGGTGTCAGCAGTGTTTTCAGG - Intergenic
980007378 4:127558511-127558533 GAGGTGTGAGCAGTGGTGGCAGG + Intergenic
982106725 4:152017758-152017780 GGGGAGACAGCAGAGGGGGCCGG + Intergenic
982221496 4:153129308-153129330 GTGGTGACAGTAGTGGTGGTGGG - Intergenic
983240520 4:165227000-165227022 GTGGTGTCAGCAGTGTTTTCAGG - Intronic
983656149 4:170086928-170086950 GGGGTGGGAGCAGTTGTGGCCGG - Intronic
984582175 4:181522882-181522904 GTGATGATAGCAGTTGTTGCTGG + Intergenic
984703355 4:182832509-182832531 AGGATGACAACAGTGGTTGTAGG - Intergenic
984937094 4:184898870-184898892 GGGGTGATAGGAGTGGCTGTGGG - Intergenic
985110696 4:186544083-186544105 TGGGGGACGGCAGAGGTTGCAGG - Intronic
986349818 5:6867087-6867109 AAGGTGTCAGCAGGGGTTGCTGG + Intergenic
988738739 5:34048728-34048750 GGGGTGACAGAAGAGGGTCCTGG - Intronic
989608410 5:43268493-43268515 GGGGCCACAGGAGTGGTTGGTGG + Intronic
991626805 5:68611111-68611133 GTGCTGGCACCAGTGGTTGCAGG - Intergenic
992895944 5:81245264-81245286 GGTGGGACAGCAGAGCTTGCTGG + Intronic
993252623 5:85548659-85548681 GTGGTGCCAGCAGTGGTCACAGG + Intergenic
993942205 5:94072912-94072934 GGGGTTAAAGCAGTGCATGCTGG - Intronic
994042570 5:95274970-95274992 GGTGAGGCTGCAGTGGTTGCGGG - Intronic
994840613 5:104920704-104920726 GGGGTGGCAGGAGGGGTTCCTGG - Intergenic
995605341 5:113848103-113848125 GGGGTGACAGCCGAGGTTCTGGG - Intergenic
996018662 5:118568652-118568674 TGGGTGATAACAGGGGTTGCTGG - Intergenic
997079724 5:130724082-130724104 GGGGTGACACCAGAGGTTCTTGG - Intergenic
997903885 5:137795004-137795026 GGGGAGACAGTAGAGGTGGCAGG + Intergenic
1001020031 5:168174912-168174934 TGGGAGAGAGCAGTGGTAGCTGG + Intronic
1002330495 5:178437367-178437389 AGGGTGCCAGGAGAGGTTGCAGG + Intronic
1003524276 6:6885164-6885186 GAGGTGACAGCAGTGATGCCAGG + Intergenic
1007714530 6:43848086-43848108 ATGGTGACAGCAGTGGTTGGGGG + Intergenic
1011786436 6:90850482-90850504 GGGGTAACAGCAGGGGAGGCTGG + Intergenic
1013951181 6:115783786-115783808 GGGCTGGCACCAATGGTTGCTGG + Intergenic
1015359940 6:132328478-132328500 GGGGTGATAGCACTCGTGGCCGG + Exonic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1016930318 6:149400278-149400300 GAGGTGACAGCGGTGGATGAGGG - Exonic
1018793002 6:167163840-167163862 GGGGTCACAGGAGCTGTTGCCGG - Intronic
1019509017 7:1407945-1407967 GCGGGGACAGCAGGGGTGGCAGG + Intergenic
1019543706 7:1562787-1562809 GTGGAGCCAGCTGTGGTTGCAGG - Intergenic
1019738748 7:2662695-2662717 GGGGGGACAGCAGGGGCTGAGGG - Exonic
1020009010 7:4798520-4798542 GGGGTGACAGCGTGGGTCGCTGG - Intronic
1023916336 7:44592189-44592211 GGGGTGAGAGCAGAGGTGGAGGG - Intergenic
1026837205 7:73647200-73647222 GGGGCCACAGAAGTGGTGGCCGG - Intergenic
1026931914 7:74227656-74227678 GGGGTGGCAGCAGTGGAGACAGG + Intronic
1028980492 7:96962619-96962641 GTGGAGACTGCTGTGGTTGCTGG - Intergenic
1029202931 7:98851177-98851199 GGGTTGACAGAGTTGGTTGCTGG + Intronic
1030067494 7:105671549-105671571 CGGGTGAGAGCAGAGGTTGCTGG - Intronic
1031887759 7:127258797-127258819 GTGGTGATAGCAGTGGTGGTGGG - Intergenic
1034356382 7:150453774-150453796 AGGGTGACAGTAGTGGGTGTTGG + Intronic
1034421727 7:150994371-150994393 GAGCTGACAGCAGTGGTTACAGG + Intronic
1034934736 7:155191463-155191485 GGGGTGAACTCAGTGGGTGCTGG - Intergenic
1035072784 7:156157301-156157323 GGGATGCCAGCAGTGCTCGCCGG - Intergenic
1035733301 8:1868244-1868266 GTGGGGACAGGAGTGGTGGCTGG + Intronic
1036110782 8:5899654-5899676 AGGGTGCCAGCACTGGTTCCTGG + Intergenic
1039386681 8:37142466-37142488 CGGGTGACAGGAGTTGTTTCTGG - Intergenic
1039841458 8:41296146-41296168 GGAGTGACAGCACTAGTGGCAGG + Intronic
1039896388 8:41719505-41719527 GGTGTGACAGCACTGGATGGTGG - Intronic
1040106303 8:43544256-43544278 GGGATGATAGCAGTGGATGGGGG - Intergenic
1040292147 8:46131004-46131026 GGTGAGACTGCAGTGATTGCTGG - Intergenic
1040294811 8:46143688-46143710 GGGGAGACAGCAGGGAATGCTGG - Intergenic
1042736178 8:71992072-71992094 GATGTAATAGCAGTGGTTGCAGG - Intronic
1042883316 8:73519215-73519237 GGGGTCACTGCAGTGGGTCCTGG - Intronic
1044820357 8:96152254-96152276 GGAGGGACAGCAGTGGTGACAGG - Intronic
1045318508 8:101063694-101063716 GGGGTGAGAGCAGAGGATGCGGG - Intergenic
1047774167 8:128055731-128055753 GGGGTGACTGGAGTGGCTGGTGG + Intergenic
1048145303 8:131836146-131836168 GTGGTGACAGCAGTGAATGGGGG - Intergenic
1048385607 8:133909865-133909887 GCAGTGGCAGCAGTGGTAGCAGG + Intergenic
1049207030 8:141368339-141368361 GGGGTGGCAGCGGGGGTTGTCGG + Intergenic
1049248526 8:141575833-141575855 CGGGGGACAACAGTGGTTTCAGG + Intergenic
1049277212 8:141725869-141725891 GTGGCAACAGCAGTGGTAGCCGG - Intergenic
1049311302 8:141935262-141935284 GGTGTGAGAGCAGTGCCTGCAGG + Intergenic
1049339266 8:142103248-142103270 GGGGAGACAGCACTGGGTGGAGG + Intergenic
1050171113 9:2817902-2817924 GGTTTGACAGCAATGGTCGCTGG - Intronic
1051890097 9:21932546-21932568 GGGGCCACAGGAGTGGTTGGTGG - Intronic
1051996918 9:23228259-23228281 GGGGCCACAGGAGTGGTTGGTGG + Intergenic
1053407297 9:37888165-37888187 GGCGTGGCGGCAGTGCTTGCAGG - Exonic
1053542963 9:38993736-38993758 GGGGAGACTGCAGTGGGGGCAGG + Intergenic
1053807406 9:41817253-41817275 GGGGAGACTGCAGTGGGGGCAGG + Intergenic
1054623186 9:67370174-67370196 GGGGAGACTGCAGTGGGGGCAGG - Intergenic
1056587617 9:87938699-87938721 GCGGTGGCAGGAGTGGTGGCGGG - Intergenic
1056609254 9:88114240-88114262 GCGGTGGCAGGAGTGGTGGCGGG + Intergenic
1057304518 9:93904475-93904497 GGGGTCACTGCTGTGGTTGCTGG - Intergenic
1057553337 9:96067822-96067844 GATGTCACAGCAGTGATTGCAGG - Intergenic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1058706934 9:107645266-107645288 GGGCTGGCAGCAGTGGATACGGG + Intergenic
1059987923 9:119837942-119837964 GGAGAGACAGCCCTGGTTGCAGG - Intergenic
1060306219 9:122414632-122414654 GGAGTGACAACAGTGGGTGCAGG - Intergenic
1061403592 9:130381850-130381872 GGGGTGACAGCAGTGGTTGCTGG - Intronic
1062572798 9:137193369-137193391 GGGGTCACTGCTGGGGTTGCTGG - Intronic
1186591893 X:10939375-10939397 GGAGTGACAGCAATGATTTCAGG + Intergenic
1187163783 X:16786721-16786743 GGGGTGACGACAGTGGGAGCAGG + Intronic
1187218433 X:17299763-17299785 GGGGTGGAAGCAATGGTTGTTGG - Intergenic
1189235260 X:39482130-39482152 GGGCTGACACCACTGGTTGGGGG + Intergenic
1190892949 X:54586900-54586922 TGGGTGCCAGCAGTGGTGGTAGG - Intergenic
1191055236 X:56233439-56233461 GGGGTTTCAGCAGTGGGGGCGGG + Intronic
1193080122 X:77398440-77398462 TGGGTGACAGATGTGGTTGAAGG - Intergenic
1193582956 X:83287140-83287162 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1193944073 X:87710135-87710157 TGAATCACAGCAGTGGTTGCGGG - Intergenic
1197331211 X:125155798-125155820 GGGCTGCCAGCAGTGCTTGCGGG - Intergenic
1199856729 X:151765091-151765113 TGGGTGACAGCCCTGGGTGCTGG - Intergenic
1202150801 Y:21842204-21842226 GGTGTGTCAGCAGTGGATTCTGG - Intergenic
1202386217 Y:24328731-24328753 GGGGGGAAGGCAGAGGTTGCAGG - Intergenic
1202484569 Y:25341397-25341419 GGGGGGAAGGCAGAGGTTGCAGG + Intergenic