ID: 1061403592

View in Genome Browser
Species Human (GRCh38)
Location 9:130381850-130381872
Sequence GGGGTGACAGCAGTGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061403592_1061403601 19 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC No data
Right 1061403601 9:130381892-130381914 CAGGTTTGCCATCTGTAAGATGG No data
1061403592_1061403599 0 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC No data
Right 1061403599 9:130381873-130381895 CAGCACTGCCATGAAGGCTCAGG No data
1061403592_1061403594 -6 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC No data
Right 1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG No data
1061403592_1061403602 20 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC No data
Right 1061403602 9:130381893-130381915 AGGTTTGCCATCTGTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061403592 Original CRISPR GGGGTGACAGCAGTGGTTGC TGG (reversed) Intronic