ID: 1061403594

View in Genome Browser
Species Human (GRCh38)
Location 9:130381867-130381889
Sequence CACCCCCAGCACTGCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061403591_1061403594 30 Left 1061403591 9:130381814-130381836 CCAAGGAGCTGGGCTCAGCACAA No data
Right 1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG No data
1061403592_1061403594 -6 Left 1061403592 9:130381850-130381872 CCAGCAACCACTGCTGTCACCCC No data
Right 1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061403594 Original CRISPR CACCCCCAGCACTGCCATGA AGG Intronic