ID: 1061404631

View in Genome Browser
Species Human (GRCh38)
Location 9:130386502-130386524
Sequence GACCTTCACCCTCACCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061404631 Original CRISPR GACCTTCACCCTCACCGTCC AGG Intronic
900518846 1:3096040-3096062 GACCTGCCCCCTAACAGTCCTGG + Intronic
900814387 1:4832196-4832218 CACCAGCACCCTCACCTTCCAGG - Intergenic
901215205 1:7551088-7551110 GACCTTCACCCTCACAGGGAGGG + Intronic
902547381 1:17198637-17198659 CACCATCACCATCACCCTCCTGG - Intergenic
903061713 1:20673146-20673168 GATCTTCACCTTCACCTCCCGGG - Intronic
903067861 1:20710834-20710856 GACCTTCACCTTCTCCTTTCTGG - Intronic
904288441 1:29468711-29468733 GACCACCACCCTCACCCTCAGGG - Intergenic
906254230 1:44335266-44335288 AACCTTCAGCCTCAACCTCCTGG - Intronic
912717252 1:111990928-111990950 GACCTTCCCACTCCCCATCCTGG - Intergenic
915498136 1:156295383-156295405 GACCATCTCCCACACCCTCCAGG + Intronic
915952648 1:160199775-160199797 GACCCTCACACTCATCCTCCTGG + Intronic
916673693 1:167047633-167047655 GATTTTCACCCTCACTGTCTTGG - Intergenic
917968560 1:180193552-180193574 GCCCTTCACCCTCAGGCTCCAGG - Intronic
921167180 1:212515400-212515422 GACCTTCATACACACCTTCCCGG + Intergenic
924161906 1:241241543-241241565 GACCTTCACCTTCTGCCTCCTGG + Intronic
924479248 1:244412947-244412969 CACCTTCACCTTCCCCCTCCTGG + Intronic
924557342 1:245129421-245129443 CACGTTCACACTCACTGTCCTGG + Intergenic
1064174376 10:13061547-13061569 GAGCTGCACCCTGACCATCCTGG - Intronic
1074713187 10:116194351-116194373 GACCCCCACCCTCACCTTGCTGG + Intronic
1075097488 10:119482027-119482049 GACCGTCAGCCCCACTGTCCAGG - Intergenic
1080043803 11:27787373-27787395 GACATTAACCCTAACTGTCCTGG + Intergenic
1083696729 11:64448522-64448544 GACCTTCCCCCTCCCCCTCTGGG + Intergenic
1083879224 11:65539998-65540020 AACCCTCGCCCTCACCGGCCGGG + Exonic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1091644759 12:2265107-2265129 GATCTTCAAACTCACTGTCCTGG - Intronic
1093220313 12:16413053-16413075 CACCTTCACTATCACCATCCAGG - Intronic
1094709552 12:32947774-32947796 GACTATCTCCCTCACCTTCCTGG - Intergenic
1096747746 12:53739421-53739443 GGCTCTCACCCTCACCTTCCTGG - Intergenic
1101325530 12:103712276-103712298 GCCCTTCACCCTCAGTATCCTGG - Intronic
1102659320 12:114512208-114512230 AACCTTCACCTTCACCTCCCGGG - Intergenic
1103521349 12:121538228-121538250 GCCCTGCACCCCCACCGGCCGGG - Intronic
1107319428 13:39169697-39169719 GAACTTCATCCTGACCGCCCAGG - Intergenic
1114334172 14:21670569-21670591 GATCTTCCTCCTCACCGTCATGG - Intergenic
1121103351 14:91264708-91264730 CACCTGCACCCCCACCGGCCTGG + Intergenic
1121363754 14:93287703-93287725 GACTTTCACCCTCCCGGTCTGGG + Intronic
1121801027 14:96774319-96774341 GAACTTGTCCCTCACAGTCCTGG + Intergenic
1122344761 14:101051587-101051609 GTCCTTGACCCTCAGCATCCAGG + Intergenic
1122739935 14:103866385-103866407 GACCTGCACCATCCCTGTCCAGG - Intergenic
1128380084 15:67105999-67106021 CTCCTTCTCCCTCACCATCCAGG + Intronic
1128497164 15:68205230-68205252 GACCCTCACACTCACCATTCTGG + Exonic
1132550116 16:550779-550801 GACCGGGACCCTCACCGACCGGG - Intronic
1132550141 16:550844-550866 GACCGGGACCCTCACCGACCGGG - Intronic
1132550159 16:550893-550915 GACCGGGACCCTCACCGACCAGG - Intronic
1132868823 16:2106533-2106555 CACCTTCACGCTCACGGTGCTGG - Exonic
1138912740 16:61421947-61421969 GCCCTTCAGCCTCAGCATCCTGG - Intergenic
1139211778 16:65084933-65084955 GAGCTTCACTCTCATTGTCCAGG + Intronic
1139851253 16:69952484-69952506 GACCTTCTCCCTCCCTGGCCCGG - Intronic
1139880233 16:70175396-70175418 GACCTTCTCCCTCCCTGGCCCGG - Intronic
1140372276 16:74420121-74420143 GACCTTCTCCCTCCCTGGCCCGG + Intronic
1140523882 16:75605909-75605931 GAGTTTCACCCTTACCGCCCAGG - Intronic
1143852292 17:9821993-9822015 CACCTTCTCCCTCACCGCCGTGG - Exonic
1148069516 17:44899810-44899832 GACCTTCACCCCAGCAGTCCCGG - Exonic
1151745817 17:76011247-76011269 GAGCTTCACCCTCAGCCACCTGG - Intronic
1152663349 17:81553016-81553038 TACCTCCACCCTCTCCCTCCTGG + Intronic
1160432061 18:78819275-78819297 GACCTGCCCCCCCACCCTCCAGG - Intergenic
1163490776 19:17616244-17616266 GTCCTTCCCCCTCACCCGCCTGG + Intronic
1164141114 19:22464639-22464661 CACCTTCACTCTCACCTACCTGG - Intronic
1165549737 19:36573669-36573691 TCCCTTCACCCTCCCCGGCCCGG - Intronic
1167120572 19:47514292-47514314 AGCCTTCACCCTCACCGCCCAGG + Intronic
1167262295 19:48465938-48465960 CACCTTCACCTTCACCTTCCAGG - Exonic
1167307749 19:48719052-48719074 GCCCTGCCCCCTCTCCGTCCAGG - Exonic
1168277786 19:55286727-55286749 GGCCCTCACCCTCTCCGTCCTGG - Intronic
925661033 2:6202888-6202910 CACCTTTCTCCTCACCGTCCTGG - Intergenic
926127833 2:10282859-10282881 CAGCTTCACCCTCACAGCCCTGG - Intergenic
927675070 2:25099269-25099291 GACCATCACAATCACCATCCAGG - Intronic
931573582 2:63696557-63696579 GACCTTCACCTCCACCAGCCTGG + Intronic
932575556 2:72960602-72960624 GACATTCACCCTCTCTGTTCTGG + Intronic
932752345 2:74379429-74379451 GAACTACATCCTCACCTTCCTGG - Intronic
934660654 2:96141854-96141876 AACCATCCCCCTCACCATCCTGG - Intergenic
935384431 2:102485968-102485990 GTCCTGCACCCCCACTGTCCTGG + Intronic
941912211 2:170774645-170774667 AACCTTCACCTTCACCTCCCGGG + Intergenic
943219841 2:185090620-185090642 AAACTTCTCCCTCACCATCCAGG - Intergenic
945180785 2:207088909-207088931 CACTTTCACCCCCACAGTCCAGG + Intronic
945241772 2:207682809-207682831 GAGTTTCACTCTTACCGTCCAGG + Intergenic
946024235 2:216662153-216662175 GAGCTGCACCCTCCCCGGCCTGG - Intronic
946091727 2:217231642-217231664 GACCTTGACCCTCCCCTTCAAGG + Intergenic
946165088 2:217858889-217858911 GCCCTTCACTCCCACCGGCCGGG + Intronic
948973573 2:241448218-241448240 GACCATCACCCTCCTGGTCCTGG + Intronic
1169557954 20:6769043-6769065 GACCGTAAGCCTCACCCTCCCGG + Intronic
1171110261 20:22474177-22474199 GACCTTCAGCCTGACCCTGCAGG - Intergenic
1171216225 20:23354374-23354396 GAACTTCATCCTGACCGCCCAGG + Exonic
1171459403 20:25290459-25290481 AACCTTCACCCTCTCCTTCCAGG + Exonic
1173665110 20:44757629-44757651 GACCTCCACCCCCACCTTGCAGG + Intronic
1175281903 20:57809428-57809450 AGACTTCACCCTCACAGTCCAGG - Intergenic
1176099402 20:63358158-63358180 GACCTCCAGCCTCAGTGTCCTGG - Intronic
1176199399 20:63853770-63853792 GTCATCCACCCTCACCCTCCTGG + Intergenic
1176199433 20:63853890-63853912 GTCATCCACCCTCACCCTCCTGG + Intergenic
1176199444 20:63853930-63853952 GTCATCCACCCTCACCCTCCTGG + Intergenic
1179485033 21:41704660-41704682 CACTTTCACCCCCACCTTCCAGG + Intergenic
1181558011 22:23683265-23683287 GTCCTGCTCCCTCACCCTCCTGG + Intergenic
1182847809 22:33446043-33446065 GAACTTCACCCTCAACCTGCAGG + Intronic
1184904678 22:47472969-47472991 GACCTTCAGACTCACTGCCCAGG - Intronic
1185360840 22:50405742-50405764 GGCCTTCACACTCACCTGCCAGG - Intronic
1185360856 22:50405820-50405842 GGCCTTCACACTCACCTGCCAGG - Intronic
950517903 3:13479642-13479664 GACCCGCACCCTCACCGCCGGGG - Intergenic
952931912 3:38367087-38367109 GACCCTCACCCTCACCCTTCTGG - Intronic
954656082 3:52195113-52195135 TACCATCACTATCACCGTCCGGG - Intergenic
955350417 3:58189289-58189311 GACCTTCTCCCTGACCCTGCTGG - Intergenic
955403066 3:58607330-58607352 CATCCTCACCCTCACCCTCCAGG - Intronic
955496241 3:59535939-59535961 TACCTTCACCCTCATCTTCATGG - Intergenic
960640287 3:119816712-119816734 GACCTCCAGCCTCAGCCTCCTGG - Intronic
961823305 3:129586255-129586277 GACCTTCACCCTGGCCATCTGGG + Exonic
961825772 3:129598333-129598355 GACCTCCTCCCTCACCATTCTGG + Intronic
967327576 3:188257344-188257366 GACCGTCACCCTCACTGTGCAGG - Intronic
970418585 4:15883367-15883389 GACCCTCACTCTCACTCTCCTGG - Intergenic
974588976 4:63918820-63918842 GGCCTTCAGCCGCCCCGTCCGGG - Intergenic
976864614 4:89709017-89709039 GCCCTTGACCCTCACCCTCAAGG - Intergenic
981495365 4:145385730-145385752 GTCCTTCACCCTCCCAGTCAGGG - Intergenic
984824919 4:183915793-183915815 GGGCTTCACCCTCAGGGTCCCGG + Intronic
989995786 5:50828807-50828829 CACCTTCACCTTCACCTCCCGGG - Intronic
992211024 5:74479662-74479684 CACCTTCACCCCCATCATCCAGG + Intergenic
994301836 5:98157055-98157077 TTCCTTCACACTCACCTTCCAGG + Intergenic
995031897 5:107490571-107490593 AATCTTCACCCTCACCTTTCAGG + Intronic
995756203 5:115507024-115507046 GACTTTCACCCTCACCTTTGTGG - Intergenic
997231859 5:132251333-132251355 CAGCTTCACCCTCACAGGCCTGG + Intronic
998142805 5:139709620-139709642 GGCCTTCGCCCTCACCCTGCAGG + Intergenic
1000558413 5:162755897-162755919 GACTTTCACCCTCATTGCCCAGG + Intergenic
1001738488 5:174028202-174028224 GATCTTCTCCCTTCCCGTCCTGG - Intergenic
1002123438 5:177023084-177023106 GCCCTTCACCCTCAGCGCGCTGG - Intronic
1002342640 5:178527013-178527035 CAGCTTCCCCCTCCCCGTCCTGG - Intronic
1002921241 6:1574935-1574957 GAGCTCCACGCTCACCCTCCTGG + Intergenic
1005612081 6:27535983-27536005 GACCTTCACCCCCACACCCCAGG + Intergenic
1006357966 6:33571891-33571913 GAGTTTCACCTTCACCCTCCTGG - Intergenic
1006391281 6:33760341-33760363 AACCTGCACCCTCACCCTTCAGG - Intergenic
1008366168 6:50683049-50683071 CACCTTCACCCTCACCACTCTGG + Intergenic
1010185429 6:73138444-73138466 GTCCTTCTCCTTCACTGTCCAGG - Intronic
1010696428 6:78979989-78980011 GACCTTTACCCTAACTCTCCAGG - Intronic
1016391237 6:143578212-143578234 GACCTCCATCCTCACGGTCCAGG + Intronic
1018062978 6:160104826-160104848 GAACCTCATCCTCACTGTCCTGG - Exonic
1019734609 7:2644577-2644599 GCCCTGCACCCCCACCCTCCAGG - Intronic
1022520217 7:31001352-31001374 CACCTTCAGGCTCACAGTCCTGG + Intergenic
1023502610 7:40866285-40866307 CACATTCACCCTGACGGTCCTGG + Intergenic
1026482429 7:70790284-70790306 GCCCGTCACCCCCACCGTCATGG - Exonic
1029452246 7:100647576-100647598 GACCCCCACCCCCACCTTCCTGG + Intronic
1032087105 7:128890334-128890356 GACCCTCACCATCACAGTCAGGG + Exonic
1035761310 8:2070912-2070934 GCCCGTCTCCCACACCGTCCTGG + Intronic
1035988420 8:4460405-4460427 CACCTTCCACCTCACTGTCCTGG + Intronic
1036651806 8:10648978-10649000 GGCCTACACCCTCACTGCCCTGG - Intronic
1037959248 8:23084052-23084074 GACCTTCACTTTCTCTGTCCCGG + Intergenic
1040416484 8:47200494-47200516 AACCTTGACCCTCTCCTTCCAGG + Intergenic
1041735158 8:61103180-61103202 GTGCTTCACCCTCCCAGTCCTGG - Intronic
1043823621 8:84898719-84898741 GACCCTCACCCTTACCCTTCAGG - Intronic
1045709702 8:104968889-104968911 GAGCTTCACCCTCATGGTTCAGG - Intronic
1049081140 8:140444436-140444458 GCCCTTCACCGCCTCCGTCCTGG - Intronic
1051069943 9:13153529-13153551 GACTTTCAACCTCAATGTCCTGG + Intronic
1051741852 9:20259975-20259997 GACCTCCAACCTCAGCCTCCTGG - Intergenic
1060986916 9:127825333-127825355 CACCTTCACCGTCACCGTCCGGG + Exonic
1061404631 9:130386502-130386524 GACCTTCACCCTCACCGTCCAGG + Intronic
1187212524 X:17244964-17244986 GACCTGCAGCCGCCCCGTCCGGG - Intergenic
1188407078 X:29824922-29824944 GATCTTCACCTTCTCCCTCCTGG - Intronic