ID: 1061405304

View in Genome Browser
Species Human (GRCh38)
Location 9:130390496-130390518
Sequence CTGCCCAAAGCCATCTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 215}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061405304_1061405316 19 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405316 9:130390538-130390560 GAAGGGGGAGGCCTGAAGGCCGG No data
1061405304_1061405310 1 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405310 9:130390520-130390542 GGTGTGGCTGGAGAGAATGAAGG No data
1061405304_1061405317 20 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405317 9:130390539-130390561 AAGGGGGAGGCCTGAAGGCCGGG No data
1061405304_1061405314 7 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405314 9:130390526-130390548 GCTGGAGAGAATGAAGGGGGAGG No data
1061405304_1061405319 26 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405319 9:130390545-130390567 GAGGCCTGAAGGCCGGGAGTGGG No data
1061405304_1061405311 2 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405311 9:130390521-130390543 GTGTGGCTGGAGAGAATGAAGGG No data
1061405304_1061405313 4 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405313 9:130390523-130390545 GTGGCTGGAGAGAATGAAGGGGG No data
1061405304_1061405315 15 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405315 9:130390534-130390556 GAATGAAGGGGGAGGCCTGAAGG No data
1061405304_1061405320 29 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405320 9:130390548-130390570 GCCTGAAGGCCGGGAGTGGGAGG No data
1061405304_1061405318 25 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405318 9:130390544-130390566 GGAGGCCTGAAGGCCGGGAGTGG No data
1061405304_1061405312 3 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405312 9:130390522-130390544 TGTGGCTGGAGAGAATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061405304 Original CRISPR CTGCCCAAAGCCATCTCTCA CGG (reversed) Intronic
901431984 1:9221984-9222006 CTGGCCATAGCCATGTCTCCTGG + Intergenic
903814222 1:26052790-26052812 CTGCCCAGAGCCAGCACTCTGGG + Intronic
903943456 1:26947260-26947282 CTTCTCAAAGCCAGCTCCCAGGG + Intergenic
904687834 1:32273770-32273792 CAGCCCACAGTCATCTCACAGGG - Intronic
905317435 1:37092420-37092442 CTGCCCAGTGCCAGCTCTAAAGG + Intergenic
905799474 1:40834156-40834178 CTGACCCAAGCCAGCTCTCCTGG + Intronic
906657530 1:47559440-47559462 CTGCCCAAGGGCAGCTCTCTAGG - Intergenic
906705338 1:47890652-47890674 CTGCCAAATGCCTTCTCACATGG + Intronic
906720516 1:48001051-48001073 CTGCTAAAGGGCATCTCTCAGGG + Intergenic
906805405 1:48775794-48775816 CTGCCTTAGCCCATCTCTCAGGG + Intronic
907562491 1:55403546-55403568 CTGCCCACAGGCCTTTCTCAGGG - Intergenic
907850179 1:58248661-58248683 CTGCCCAAATCCTTCTTGCAGGG - Intronic
908207503 1:61865985-61866007 CTGCCCAGGGCCCTCTATCATGG - Intronic
909110425 1:71469632-71469654 CTGTCCCAAGCTATCTCTGATGG - Intronic
909138179 1:71828890-71828912 CTGCCCTCAGCCTTGTCTCATGG - Intronic
909541008 1:76791399-76791421 CTACCCAAAGCTATGTCACATGG + Intergenic
911444822 1:97978543-97978565 CTGCCCCAATCCAGCTTTCACGG + Intergenic
911629771 1:100169948-100169970 CTGCATAAAGCCATATCCCAGGG + Intronic
917200048 1:172505190-172505212 CTTACAAAAGCCATGTCTCAAGG + Intergenic
918697719 1:187564075-187564097 CTGCCCCCAGCCATCTTTCTGGG + Intergenic
919642869 1:200062707-200062729 CTGATGAAAGCCATCTCTCATGG + Intronic
919918970 1:202156988-202157010 TTTCTCAAAGCCATCTCTCTGGG + Intronic
922713217 1:227848955-227848977 TTGACCAAAGCCTGCTCTCAAGG - Intergenic
922984429 1:229855050-229855072 CTGCCCAAAGCCAACTGACTAGG - Intergenic
924074797 1:240322758-240322780 CAGCCACAAGCCCTCTCTCATGG - Intronic
924162759 1:241251035-241251057 CAGGTCAAAGCCATCTTTCACGG + Intronic
924374507 1:243391307-243391329 CTCTCCCAAGCCATGTCTCATGG + Intronic
1062822015 10:541742-541764 CTGACCACACCCATCTCTCCTGG + Intronic
1069688990 10:70337303-70337325 AGGCCCAGAGCCATCTCTCAGGG + Intronic
1075491643 10:122876365-122876387 CTAACAAAAGCCTTCTCTCAAGG - Intronic
1076980622 11:202723-202745 CTGCCCAAAGTCAACCCTGATGG + Intronic
1078229796 11:9429989-9430011 CATCCCAAAGCCATCTCCCCCGG - Intronic
1080687064 11:34524665-34524687 TTGCCCCAAGCCATCTGCCAGGG - Intergenic
1080744789 11:35099077-35099099 CTGCCCAAACAGATTTCTCAAGG + Intergenic
1080770028 11:35332050-35332072 CTGTCCAAAGCCATCTCCATGGG - Intronic
1083773686 11:64882592-64882614 CTCCCCAGAGCCATCACCCAAGG - Intronic
1084604002 11:70162157-70162179 CTGCCCAAGGCCCTCACTCCCGG - Intronic
1085047988 11:73364300-73364322 TTGCCCAAAGCCACATCTCCAGG - Intronic
1085457674 11:76674365-76674387 CTGCCCATAGCCATCTGACGAGG + Intergenic
1085550038 11:77360671-77360693 CTGCCCAAAGCTATCACCTATGG - Intronic
1087928660 11:103950097-103950119 CTTCCCAAATCTATATCTCAAGG - Intronic
1089309794 11:117550489-117550511 CTGCCCATGGCCAGCTTTCAGGG + Intronic
1089891340 11:121884428-121884450 CTTCCCAGAGCCTTCTCTCTAGG - Intergenic
1090846617 11:130534782-130534804 CTGCCAAAAGCATTCTCTTACGG - Intergenic
1091158624 11:133398352-133398374 CAGGACAGAGCCATCTCTCAAGG + Intronic
1092365134 12:7871457-7871479 CTGCCCACGACCTTCTCTCAGGG + Intronic
1093348158 12:18065874-18065896 TTGTTCAATGCCATCTCTCAGGG - Intergenic
1095631395 12:44381088-44381110 CTGCAGCAAGCCATCTGTCAAGG - Intronic
1095981931 12:47978934-47978956 CTGCCCAGAGCTGTCTCACATGG - Intronic
1096478499 12:51923117-51923139 CTGCCCCAGGCCTTCTCTTAGGG - Intronic
1097709393 12:62901756-62901778 CTGCTCAAAGCTACCTGTCAGGG - Intronic
1098558519 12:71846776-71846798 CGGACCAAGGCCATGTCTCAGGG - Intronic
1098703348 12:73656611-73656633 ATGCCCGGAGCCATCTTTCACGG + Intergenic
1099802913 12:87479773-87479795 CTCCCCCAACCCATCTCTCCGGG - Intergenic
1099902868 12:88734357-88734379 CTACCCAATGCCATCTCTGTTGG + Intergenic
1101835069 12:108289230-108289252 GTGCCCAGAGCCTTCTCTCTGGG - Exonic
1102934302 12:116883574-116883596 CTCCAAAAAGCCACCTCTCAAGG - Intergenic
1103182245 12:118923676-118923698 CTCCCCAAAGCCAACTCTCTGGG + Intergenic
1104042472 12:125139430-125139452 TTGCCCAAAGTCATGCCTCAGGG - Intronic
1104925301 12:132310885-132310907 CTGTCCACAGCCATCCTTCAGGG + Intronic
1105742147 13:23337931-23337953 CTGACCAAAGTCTTCTCTGATGG - Exonic
1106135761 13:26972277-26972299 CTGCTGAGAGCCATCTGTCAGGG - Intergenic
1106628438 13:31444551-31444573 CTCTCCAAAACCATCTCTCTAGG + Intergenic
1113523725 13:110957871-110957893 TTTCCCAGGGCCATCTCTCATGG - Intergenic
1115312354 14:31992353-31992375 CTGACCACAGCCGTCTCTCATGG + Intergenic
1115950195 14:38712614-38712636 GTTCCCAAAGGCATCTCTCATGG - Intergenic
1122867409 14:104613472-104613494 CTGGCCAAAGCCAGCTGTCCTGG - Intergenic
1202856072 14_GL000225v1_random:52922-52944 CTGCTCAAAGCAAGCTCGCAGGG - Intergenic
1125042973 15:35213670-35213692 TTCCCCAAAGCCATCTCACCTGG + Intergenic
1125465097 15:39943175-39943197 CTGGCCAAAGCCTTCTGTCTGGG - Intronic
1126550872 15:49927914-49927936 CTGCTGAGAGCCATCTTTCAAGG + Intronic
1128304299 15:66588028-66588050 CTGTCCAATGCCATGTGTCACGG - Intronic
1128714960 15:69901241-69901263 CTGCCCAGGGCCATGACTCAGGG - Intergenic
1133881512 16:9786901-9786923 TTGCCCAAAGCCCTATCTAAGGG + Intronic
1133910935 16:10065974-10065996 TTTCCGAAAGCCCTCTCTCAAGG - Intronic
1134077255 16:11300494-11300516 CTGTCCAATGACAACTCTCACGG + Intronic
1136922391 16:34343878-34343900 CTGCCCAAAGCACTCTCCCCAGG + Intergenic
1136982182 16:35067928-35067950 CTGCCCAAAGCACTCTCCCCAGG - Intergenic
1138194859 16:55044599-55044621 CTCTCCCAAGCCATCTCTCCTGG + Intergenic
1139491780 16:67289821-67289843 CTGCCCCAGGGCATCTCACAGGG + Intronic
1139670880 16:68491920-68491942 CTTCCCAAAGCCAACTCAGAGGG - Intergenic
1141054992 16:80805341-80805363 CGTTCCTAAGCCATCTCTCATGG + Intergenic
1141093260 16:81145020-81145042 CAGCCCAAACCCAGCTCTCTGGG + Intergenic
1141492314 16:84382474-84382496 CTGCCTTTTGCCATCTCTCAGGG + Intronic
1141533395 16:84662023-84662045 CTGCCCAAGGCCATCGCTGGCGG + Exonic
1143727966 17:8862905-8862927 CTGCCCACAGCATTCACTCATGG + Intronic
1143770411 17:9164923-9164945 AAGCCCAAAGCCATCTCTCCCGG - Intronic
1144098715 17:11924968-11924990 CTTTTCAAATCCATCTCTCAGGG + Intronic
1145302149 17:21648232-21648254 CCACCCAATGCCATCTCCCAGGG - Intergenic
1145348164 17:22055084-22055106 CCACCCAATGCCATCTCCCAGGG + Intergenic
1150281815 17:63933275-63933297 CTGCACAAGGGCATCTCTGAAGG - Intergenic
1152579550 17:81160001-81160023 CTGCTCAAGGCCACCTCTCACGG - Intronic
1155004289 18:21714179-21714201 TCGCCCAAAGCCATCACTCTAGG + Intronic
1155163593 18:23215241-23215263 CTGCCCGAAAACATCTCTCTGGG - Intronic
1156365432 18:36421890-36421912 CACCCCAAAGCCCTCTCTCCTGG + Intronic
1156625352 18:38901576-38901598 TTTCCCACTGCCATCTCTCATGG + Intergenic
1157133873 18:45035084-45035106 CTGCCCAATGCACTCTCCCAAGG + Intronic
1157729358 18:49990347-49990369 CTGCTCAAAGCCCTCCGTCATGG - Intronic
1162788461 19:13050951-13050973 CTGCCCAGGGCCATCTCCAAGGG - Intronic
1163604101 19:18264826-18264848 TTGGCCAAAGCCCTCTCCCAGGG - Exonic
1165091988 19:33392474-33392496 CTGCCCAAACCCAGCCCCCATGG - Intronic
1168102522 19:54148646-54148668 CTGCTCAAAGCCACCTCTGCCGG - Exonic
1168109581 19:54184532-54184554 CAGCCCAAGGCCATCTTACAAGG - Intronic
1168513046 19:56988581-56988603 ATGCCCACCACCATCTCTCAGGG - Intergenic
925201597 2:1971431-1971453 CGGCCCAAAGCCTTCTCTTTTGG - Intronic
926149755 2:10418775-10418797 CTGCTCAAAACCATCCCCCAGGG - Intronic
926285722 2:11486119-11486141 CTGCCCAAAGTCAGCCCTAATGG - Intergenic
926300277 2:11597046-11597068 GTGCCCACTGCCCTCTCTCACGG - Intronic
926734948 2:16066419-16066441 CTGCTCAAATCAATCTTTCACGG + Intergenic
928034506 2:27809198-27809220 CTGGCCCAAGCCCACTCTCAGGG - Intronic
928115768 2:28544353-28544375 CTCTCCCAAGCCCTCTCTCAGGG + Intronic
929892598 2:45930787-45930809 CTTCCTAAAGCCAACTCTTAGGG - Intronic
929892605 2:45930843-45930865 CTTCCTAAAGCCAACTCTTAGGG - Intronic
932494277 2:72138765-72138787 TTGCCCAAGGCCATCCCTTAAGG - Intronic
935496992 2:103793943-103793965 CTGCCCAAAGCCATGGCAAATGG - Intergenic
936105813 2:109623555-109623577 CTGCCAAAAGCCATCCATCGGGG - Intergenic
937885097 2:126894198-126894220 CTTCCCACACACATCTCTCAGGG - Intergenic
942023463 2:171890065-171890087 CAGGCCCATGCCATCTCTCATGG - Intronic
944539774 2:200744027-200744049 CTCCCCAAGGCCCACTCTCAAGG - Intergenic
944564649 2:200976977-200976999 CTGATCAAAGCCATTTCACAGGG + Exonic
946033186 2:216721353-216721375 CTGCCAACAGCCATCACCCATGG + Intergenic
946731960 2:222718750-222718772 CAGCCCAAATTCATCTTTCAAGG - Intergenic
947984346 2:234436351-234436373 CTGCCCAATGCCAACGCTGAAGG + Intergenic
948439591 2:237978239-237978261 CTGCCCACAGCCCTCACTGAGGG + Intronic
948609242 2:239156248-239156270 CTGCCCAGCGCCATCCCTGAAGG + Intronic
948785764 2:240351926-240351948 CCACCCATAGTCATCTCTCAGGG - Intergenic
948859631 2:240746559-240746581 CTGCCCAATGCCTTTTCTCTTGG - Intronic
1169207567 20:3748873-3748895 CTCCCAAATGCCATCTCCCAGGG + Intronic
1171162403 20:22940030-22940052 ATGCCAAAATCCCTCTCTCAAGG + Intergenic
1171214621 20:23343073-23343095 CTGCCCAAAGGCATGTCTTCTGG - Intergenic
1171558117 20:26096551-26096573 CCACCCAATGCCATCTCCCAGGG + Intergenic
1173177068 20:40772499-40772521 CTCCCCAAAGCCATCCATTATGG + Intergenic
1174524371 20:51159468-51159490 CAGCCCACAGCCATCTGTGAAGG - Intergenic
1175426435 20:58870348-58870370 CTGCCCTCAGCCACCACTCAGGG - Intronic
1178643999 21:34369607-34369629 CTCCCCAGAGCCATCTCTTTGGG - Intronic
1179184622 21:39075493-39075515 CTGGGCATAGCCATCTCTTATGG - Intergenic
1180611380 22:17100421-17100443 CTGCCCAAGCCCATCCCTGATGG + Exonic
1181266974 22:21636108-21636130 CTGCCCAAACCCAGTTGTCAAGG + Intronic
1183194704 22:36345367-36345389 CTCCACATAGCCATGTCTCATGG + Intronic
1183263950 22:36814369-36814391 CTCCCCTAAACCATCTCACAAGG - Intronic
1183756896 22:39775772-39775794 CTACCCAAAGCCATCTTCCTGGG - Intronic
1184273107 22:43395904-43395926 CTGGCAACAGTCATCTCTCAGGG + Intergenic
1184504494 22:44892738-44892760 CTCCCCAAAGCCAACTCTGCAGG - Intronic
1185193245 22:49452034-49452056 CTGACCAAAGCCCTCCCTCTAGG + Intronic
949530186 3:4947808-4947830 TGGCTCAAAGTCATCTCTCAGGG + Intergenic
951055369 3:18141036-18141058 CTAACCAAAGCTTTCTCTCAGGG - Intronic
951128612 3:19014262-19014284 CCTCCCCAAGCCATATCTCAAGG + Intergenic
951583350 3:24189433-24189455 CAGCACAAAGACATCTGTCAGGG + Intronic
953034089 3:39196640-39196662 CTGCCCAAACCCAACTTTGATGG - Intergenic
953243973 3:41174437-41174459 GTGCCTCAAGCCATTTCTCAGGG + Intergenic
953332199 3:42063287-42063309 CTGCCCTAAGCCATTGCTGAAGG + Intronic
953444799 3:42954075-42954097 CTGCCCATACACATTTCTCATGG + Intronic
953773916 3:45799642-45799664 CTGCCCAAAGCTACCACACAGGG - Intergenic
954155356 3:48682220-48682242 CTGCCCACAGCCAGGGCTCAGGG - Intronic
957566784 3:81894395-81894417 TAGCACAAAGCTATCTCTCAAGG - Intergenic
958866779 3:99509959-99509981 CTTTCCAAACCCTTCTCTCAAGG - Intergenic
959520638 3:107319610-107319632 CTGCCCTTAGCCATGACTCAAGG - Intergenic
960131519 3:114061346-114061368 CAGCACAGAGCCATCACTCAGGG - Intronic
970191480 4:13523066-13523088 ATGCCCAAGGCCTCCTCTCAGGG - Intergenic
970244314 4:14042946-14042968 CTGCCCAAAGGCATGTCAAAAGG - Intergenic
972382943 4:38536138-38536160 ATGCCCACAGCCCCCTCTCAGGG + Intergenic
972791915 4:42380826-42380848 CTGGCCTAAGCAATTTCTCATGG + Intergenic
985712864 5:1439793-1439815 TGGGCCAAAGCCACCTCTCAGGG - Intronic
985726955 5:1521751-1521773 CTGCCCAAAGCCTTCAATCTCGG + Intronic
986165451 5:5268578-5268600 CTGCCCAGAGGTATCCCTCAAGG + Intronic
989552033 5:42746500-42746522 CTGCCCAGAGCCTTCAGTCAAGG + Intergenic
991554466 5:67879958-67879980 CTGTCCCATACCATCTCTCATGG + Intergenic
992435751 5:76754834-76754856 CTGCCCAAATCCATACCTGAAGG + Intergenic
992876772 5:81064072-81064094 CTGCCCAAAGGTATCTCACAAGG + Intronic
994337375 5:98583598-98583620 CAGCCCAAAGCTCCCTCTCAGGG + Intergenic
994498175 5:100539688-100539710 CTGCCCAAACCCAGCTCTGCTGG + Intronic
996838751 5:127823103-127823125 CTCCCCAAAAGCATCTCTCATGG + Intergenic
997719088 5:136063907-136063929 CTCCCCAAAACCATCCCTCGGGG - Intergenic
1001107500 5:168867670-168867692 CTTCCCAAAACCAACTCACATGG - Intronic
1001260042 5:170220526-170220548 TTGCCCAAGGTCATTTCTCAAGG - Intergenic
1001644493 5:173269976-173269998 CTGCCCAGGCTCATCTCTCAGGG + Intergenic
1002516813 5:179765064-179765086 CTGCCCACAGCCATCTCGTCTGG - Intronic
1004344989 6:14840884-14840906 CTGGCAAAGACCATCTCTCAAGG + Intergenic
1007116365 6:39345920-39345942 CTGCCCAATGCCATCACACTGGG - Intronic
1007231627 6:40352132-40352154 CTGCCCAGAGCCTTTTCTCTTGG - Intergenic
1007496498 6:42263402-42263424 CCGCCCAAGCCCAGCTCTCAGGG - Exonic
1008132905 6:47738861-47738883 CTGCCCACAGTCAGCTGTCATGG + Intergenic
1011501147 6:87991423-87991445 CCGTACAAAGCCATTTCTCAGGG + Intergenic
1011629776 6:89312124-89312146 CAGCCCAGAGTCAGCTCTCAAGG + Intronic
1013360834 6:109392577-109392599 CTGGCCAGAACCATCTCTCATGG + Intronic
1013983047 6:116156624-116156646 ATGACCAAAGTCATCTTTCAAGG - Intronic
1016987078 6:149903685-149903707 CTGCCCACATCCATGGCTCAGGG - Intergenic
1020339806 7:7097791-7097813 CTGTTCAAAGCCATCTCTGATGG - Intergenic
1022470846 7:30681234-30681256 CACCCCAACACCATCTCTCAAGG - Intronic
1023085518 7:36566822-36566844 CTGCGCAGAGCCCCCTCTCAAGG + Intronic
1024053884 7:45647103-45647125 GTGGCCAGGGCCATCTCTCAAGG + Intronic
1024871009 7:53961680-53961702 TTGCCCAAAGCCCTGTCACAGGG - Intergenic
1025128435 7:56363447-56363469 CTGGCCCAAGCCTTCTCCCACGG + Intergenic
1026440347 7:70438500-70438522 CTGCCCCATGCCATTTCTCCAGG + Intronic
1027261811 7:76470127-76470149 CTGCCCCCAGCCATCTTTCTGGG - Intronic
1027313193 7:76968226-76968248 CTGCCCCCAGCCATCTTTCTGGG - Intergenic
1028709644 7:93892234-93892256 CTCCCCAAGGCTATCTCTCTGGG - Intronic
1028781718 7:94744912-94744934 CTGACCATGGCCAGCTCTCATGG + Intergenic
1033366743 7:140677974-140677996 CTGTCCAGGTCCATCTCTCATGG - Intronic
1034392651 7:150799296-150799318 CTGCCCATTGGCATGTCTCATGG + Intronic
1036884421 8:12540859-12540881 CTGCCCAGAGCCTTGGCTCATGG - Intergenic
1039117719 8:34111229-34111251 TTGCCCAAAGCCTTCTTTCTAGG + Intergenic
1040956545 8:52985491-52985513 CTTCCTAAAGCAATGTCTCATGG + Intergenic
1043187896 8:77178276-77178298 CTTCCCAAAGAATTCTCTCATGG + Intergenic
1045290807 8:100831056-100831078 CTCCGCAAAGCCATCTCTTGCGG - Intergenic
1045663704 8:104465052-104465074 CTGCCCAGATCCTTCTCTCTGGG + Intronic
1047480412 8:125276839-125276861 CTGCCAAATGCCATCTCTTCTGG + Intronic
1049599912 8:143502922-143502944 CTGGCCAAGGCCGGCTCTCAGGG + Intronic
1049905083 9:209044-209066 TTTCCCAAAGTCATATCTCACGG - Intergenic
1055119201 9:72638710-72638732 CTGCCCTCAGTCATCTCCCATGG + Intronic
1055276794 9:74626507-74626529 CTCACTCAAGCCATCTCTCAGGG + Intronic
1055583194 9:77729836-77729858 CAGCCCCAAGCCAGCTCACATGG - Intronic
1055838483 9:80473921-80473943 CGGCCCAAAGCCATATCTTAAGG + Intergenic
1056246727 9:84702867-84702889 TTTCCCAAAGCCGTCTGTCATGG + Intronic
1057523845 9:95782818-95782840 CTGCCCAATGCGTCCTCTCAGGG - Intergenic
1057745654 9:97748828-97748850 CTTCCCAAGGCCATCTCTCCAGG + Intergenic
1058541097 9:106013562-106013584 CTCCCCAAATCCATCACTCTGGG + Intergenic
1058637229 9:107048572-107048594 CTGCCCAAACCCAGCAGTCAGGG - Intergenic
1058653243 9:107196670-107196692 TTGCCTAATGCCATCTCTCGGGG + Intergenic
1058779921 9:108322982-108323004 CTGCCTAATGCCAGTTCTCAGGG + Intergenic
1060316353 9:122514997-122515019 CTGCCCGAGGGCATCTCTCCTGG + Intergenic
1060431472 9:123554457-123554479 CTGCCCCAAGCAATCTTACATGG + Intronic
1061405304 9:130390496-130390518 CTGCCCAAAGCCATCTCTCACGG - Intronic
1185655351 X:1679914-1679936 CTCCGCAAAGCCATCTCTTGTGG - Intergenic
1193037903 X:76973326-76973348 CTTCCCCAAGCCATTTCTCTTGG + Intergenic
1193882640 X:86943110-86943132 ATTCCCAAATCCATCTCTCTAGG + Intergenic
1194451739 X:94051967-94051989 CTCCCCAAAGCTATCCCTTAGGG + Intergenic
1198401946 X:136277256-136277278 CTGACCAAAGTCCTCTCTAATGG - Intergenic
1199799692 X:151237341-151237363 CTGCCCATACCCATTTCCCAAGG - Intergenic