ID: 1061405320

View in Genome Browser
Species Human (GRCh38)
Location 9:130390548-130390570
Sequence GCCTGAAGGCCGGGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061405304_1061405320 29 Left 1061405304 9:130390496-130390518 CCGTGAGAGATGGCTTTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1061405320 9:130390548-130390570 GCCTGAAGGCCGGGAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061405320 Original CRISPR GCCTGAAGGCCGGGAGTGGG AGG Intronic
No off target data available for this crispr