ID: 1061405644

View in Genome Browser
Species Human (GRCh38)
Location 9:130391788-130391810
Sequence GAAGGATGAGGCCCGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061405644_1061405653 16 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405653 9:130391827-130391849 GTTGCTGGCGGCAGAAGTCCAGG No data
1061405644_1061405650 1 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405650 9:130391812-130391834 CAAGGGACCACTGTGGTTGCTGG No data
1061405644_1061405651 4 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405651 9:130391815-130391837 GGGACCACTGTGGTTGCTGGCGG No data
1061405644_1061405648 -6 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405648 9:130391805-130391827 TCCTTCACAAGGGACCACTGTGG No data
1061405644_1061405654 29 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405654 9:130391840-130391862 GAAGTCCAGGTCTCCACTTCTGG No data
1061405644_1061405655 30 Left 1061405644 9:130391788-130391810 CCATGCAGCGGGCCTCATCCTTC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1061405655 9:130391841-130391863 AAGTCCAGGTCTCCACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061405644 Original CRISPR GAAGGATGAGGCCCGCTGCA TGG (reversed) Intronic
901287706 1:8094295-8094317 GAAGGAAGAGGGAAGCTGCAGGG + Intergenic
901924155 1:12555343-12555365 CAAGAATGAGGCCAGGTGCAGGG - Intergenic
903524113 1:23980027-23980049 GGCGGCTGAGGCCCGCTGCGCGG + Intronic
906479890 1:46193068-46193090 GAAGGATGAGGCCCAGTGAGGGG + Intronic
907270545 1:53288439-53288461 AAAGGATGGGGCCTGCGGCATGG + Intronic
921302476 1:213764369-213764391 GGAGGAAGAGGCCCCCTGAAGGG - Intergenic
1062956811 10:1545850-1545872 GCAGGATGAGGGAGGCTGCAGGG + Intronic
1071601195 10:86959477-86959499 GCAGGAAGAGGCCCTCTGAAGGG + Intronic
1074983645 10:118639336-118639358 GAAGGATGAGGGACTCTGCTGGG - Intergenic
1076254616 10:129012223-129012245 GAAGGATGGGGGCTCCTGCATGG + Intergenic
1077288229 11:1777103-1777125 GCAGGATGAGGCCAGAAGCAAGG + Intergenic
1083064465 11:59910285-59910307 GAAGGGTGAAGCCCAGTGCAAGG - Intergenic
1083087711 11:60167912-60167934 GAAGGATGATGCATCCTGCAGGG - Intergenic
1083643593 11:64159031-64159053 GAAAAATGAGGCCGGGTGCAGGG + Intronic
1089230007 11:116965604-116965626 GAGGGAAGAGGCCAGGTGCAGGG + Intronic
1090478164 11:127043438-127043460 TAAAGATGAGGCCTGATGCATGG + Intergenic
1092153657 12:6268368-6268390 GAATTAAGAGGCCTGCTGCATGG - Intergenic
1093496586 12:19764300-19764322 GAAGGTTGAAGCCCAATGCAAGG + Intergenic
1094359558 12:29615608-29615630 GATGGATGAGGGACCCTGCAAGG - Intronic
1094447242 12:30545448-30545470 GAAAGATGAAGCCCAATGCAAGG - Intergenic
1101874465 12:108589446-108589468 GAAGGCAGAGGCCGACTGCAGGG + Intergenic
1102023546 12:109700119-109700141 GAATGATGAGGCCTGCCTCATGG + Intergenic
1102520725 12:113476363-113476385 GAAGGCTGAGCCCCGCTGTCTGG + Intergenic
1112661976 13:101520653-101520675 GAAGGATGTGGGACCCTGCAAGG + Intronic
1113705273 13:112426990-112427012 GAAGGATGATGTTAGCTGCAGGG + Intronic
1118263426 14:64269978-64270000 GGAGGATGAGGACAGCTACATGG + Intronic
1121111010 14:91313175-91313197 CAAGGAGCTGGCCCGCTGCAGGG - Exonic
1121320800 14:92990683-92990705 GACAGATGAGGCCTGCTGCTGGG - Intronic
1122084554 14:99290591-99290613 GATGGATGAGGCCCAGTGCCTGG - Intergenic
1122903682 14:104792386-104792408 GGAGGATGAGGCCCTGTGCAGGG - Intronic
1122940530 14:104979040-104979062 TAAGGATGAGGCGTTCTGCAGGG + Intergenic
1124072261 15:26406422-26406444 GAAAGAGGAGAGCCGCTGCAGGG - Intergenic
1124462799 15:29908521-29908543 GAAGAATGAGGGTGGCTGCAGGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126503160 15:49370030-49370052 CAAGGAAGAGGCCATCTGCAAGG + Intronic
1127364221 15:58272213-58272235 GAAGGTTGACGCCCCCTGCATGG - Intronic
1127793090 15:62415650-62415672 AAAGGAAGAGGCCCGCTGCCAGG + Intronic
1128979420 15:72175638-72175660 GAGGGATGAGCCCCTCTGCTGGG - Intronic
1129720020 15:77872820-77872842 GGTGGATGAGGCTCGCTGCCTGG - Intergenic
1132663009 16:1069896-1069918 CAAGGATGGGGCCTTCTGCAGGG - Intergenic
1133685039 16:8158513-8158535 GAAGGGAGAGGCCGGGTGCAAGG - Intergenic
1138400965 16:56743722-56743744 GAAGGATGAGGAAGGCTTCAAGG - Intronic
1139331500 16:66195892-66195914 GAAGGAGGAAGTCCGCTGCTTGG - Intergenic
1142974712 17:3636551-3636573 GGAAGATGAGGTCCGCTGCCAGG - Exonic
1143251530 17:5526639-5526661 GAAGGACAAGGCCAGCTTCATGG + Intronic
1145978628 17:28998502-28998524 GAAGGGGGAGACCCGCTGCTTGG - Intronic
1145998068 17:29115704-29115726 GAAGGAGGTGGAGCGCTGCAGGG + Exonic
1146926753 17:36750868-36750890 GAAGGATGATACCTGGTGCATGG + Intergenic
1147693790 17:42335969-42335991 GAGGGAGGGGGACCGCTGCAGGG + Intronic
1148966147 17:51437803-51437825 GAATGATGAGGACCCCTTCAGGG + Intergenic
1149891086 17:60391539-60391561 GAAGGATGAGGGGGGCTGGATGG + Intronic
1150131160 17:62670007-62670029 GAAGGAAGGGGCCCGCTGGGAGG + Intronic
1152379336 17:79934352-79934374 GAAGGATGATCCCACCTGCACGG - Exonic
1154358228 18:13638906-13638928 GAGGACTGAGACCCGCTGCAAGG + Intronic
1158768459 18:60485084-60485106 GAAGGATGAAGCCCAATCCAAGG + Intergenic
1159007160 18:63023405-63023427 GAAGGAAGAGGCGGGCTGCTGGG - Intergenic
1160698081 19:494274-494296 GAGGGCTGAGGCCCCTTGCAGGG - Intronic
1161161108 19:2762291-2762313 GAAGCAGGAGGCCGGCCGCAGGG - Intronic
1166569129 19:43782586-43782608 GAAGGAAGAGGCCCCCAACAGGG + Intergenic
1167402063 19:49279485-49279507 GATGGATGAGGCCCAAGGCATGG + Intergenic
1167673547 19:50870609-50870631 GACGGGAGAGGCGCGCTGCAGGG - Intronic
925047014 2:780254-780276 GAAGGATGAAGCCAGCAGCAGGG - Intergenic
926681996 2:15671174-15671196 GAAGGCTGAGGTCCCCTGCCAGG - Intergenic
926915878 2:17892357-17892379 GAAAGGTGAGGCCCAATGCAAGG - Intronic
929856819 2:45644264-45644286 AGGGGATGAGGCCCGGTGCATGG + Intergenic
933837086 2:86254872-86254894 GAAGGATGAGACCCGGTGGGTGG + Intronic
937121589 2:119443075-119443097 CAAGGATGCTGCCCGTTGCATGG + Intronic
937302581 2:120852305-120852327 TCAGGAGGAGCCCCGCTGCATGG - Intronic
937795678 2:126015958-126015980 AAAGGATGAGTCCCTTTGCAGGG - Intergenic
938252414 2:129826137-129826159 GAAGGATGAGGCCTGCAGTAAGG + Intergenic
943783183 2:191847001-191847023 GTAGGATGAGGCCCGCTGGTTGG + Exonic
944663844 2:201942758-201942780 GAAGGATGTGGCCCACTGGGAGG + Intergenic
1169205025 20:3734534-3734556 GGAGGCTGAGCCCCGCTTCAGGG - Intronic
1169517338 20:6332442-6332464 GAAGGGTGAAGCCCAATGCAAGG - Intergenic
1170617782 20:17968374-17968396 GCAGGAGGAGGACCGCAGCAAGG - Exonic
1170808715 20:19656522-19656544 GAAGGATGAAGCTTGCTGGAAGG - Intronic
1172098472 20:32472303-32472325 GAAGTCTGAGGCCTGCTGTAAGG - Intronic
1172312107 20:33926762-33926784 GAAGGGTGAGGCCAAGTGCATGG + Intergenic
1172507678 20:35475700-35475722 GAAGAATGAGGCAGGCTGCATGG - Intronic
1174072084 20:47906274-47906296 GAAGGAGGAGGCGCGCCTCAGGG + Intergenic
1174151959 20:48492395-48492417 GAAGGAGGAGGCGCGCCTCAGGG - Intergenic
1174190098 20:48734495-48734517 CAAGGATGAGGCCGAGTGCAAGG + Intronic
1175292969 20:57890618-57890640 GAAGGATGAGGCCCTTTGGCTGG - Intergenic
1176042486 20:63072721-63072743 GAAGGGAGGGGCCCGCTCCACGG + Intergenic
1177043987 21:16146575-16146597 CAAGAATGAGTCCTGCTGCATGG + Intergenic
1177995226 21:28089226-28089248 GAAAGATGAAGCCCAATGCAAGG - Intergenic
1178923319 21:36754522-36754544 GAGGGCTGAGGCTCGCTGCAGGG + Intronic
1179149364 21:38796837-38796859 GAGGGAGGAGGCCGGCGGCAGGG - Intergenic
1179488682 21:41726924-41726946 GCAGGATGAGGCCGGCAGCAAGG + Intergenic
1179893725 21:44350351-44350373 GAAGGTTGAGGCGGGGTGCAAGG + Intronic
1181429088 22:22866879-22866901 GAAGAATGAGGCCCTGGGCAGGG - Intronic
1181581633 22:23832009-23832031 GAGGGGTCAGGCCTGCTGCAGGG + Intronic
1181762528 22:25067966-25067988 GAGGGATGATGCCAGCTGCCTGG - Intronic
1182355881 22:29722054-29722076 GATGGATGAGGGCCTCTGGAGGG - Intronic
1185187033 22:49407352-49407374 GAAGGCTGATGCCCGCAGCCTGG - Intergenic
949603915 3:5633606-5633628 GAATGATGAAGCCCAATGCAAGG - Intergenic
950116370 3:10452692-10452714 GAAGGCTGAACCCCGCTGGAGGG + Intronic
950239069 3:11351591-11351613 GAAGGAAGAGGCTCGATGCCAGG - Intronic
950544260 3:13629423-13629445 GGAGGATGAGGCCAGCTGGAAGG - Intronic
951709622 3:25575034-25575056 GAAGGTTGGGGACCGCTGCTGGG - Intronic
951866960 3:27319445-27319467 GAAGAATGAGGACTGCAGCATGG + Intronic
954125362 3:48525046-48525068 GAAGGATGAGGCCCGAGACAGGG + Intronic
965052610 3:163670602-163670624 GAAAGATGAAGCCCAATGCAAGG - Intergenic
975116599 4:70687829-70687851 GAAGGCAGAGCCCCGCTGCAGGG - Intergenic
981917662 4:150052270-150052292 GAAGGATGAGGCTGGGTGAATGG - Intergenic
982834689 4:160109274-160109296 CCAGGAAGAAGCCCGCTGCAGGG - Intergenic
983973297 4:173900681-173900703 GAAGGATGAGGCCTTCAGCTAGG + Intergenic
985866233 5:2516569-2516591 GAGGGATGGGGCTCTCTGCAGGG - Intergenic
985963335 5:3320419-3320441 GAAGGCTGGGGCTCTCTGCAGGG - Intergenic
989710193 5:44388734-44388756 GAAGGGTAAGACCCGATGCAAGG + Exonic
997662947 5:135603516-135603538 GAGGGATGAGGCCAGAGGCAGGG - Intergenic
998106675 5:139473301-139473323 GTAGGATGAGGGCCTCTCCACGG - Intergenic
1000016835 5:157285440-157285462 GAAGGTGGAGGCTCGATGCATGG - Exonic
1000779771 5:165465748-165465770 GAAGGGTGAAGCCCAATGCAAGG + Intergenic
1001603389 5:172943615-172943637 GTAGAATGGGGCCCACTGCAGGG - Intronic
1001632673 5:173187564-173187586 GAAGGATGAGGGCAGGTGCCTGG + Intergenic
1002129019 5:177068120-177068142 GATGGGTGAGGCAGGCTGCAGGG - Intronic
1010117761 6:72335390-72335412 AAAGGATGAAGCCCTTTGCAGGG - Intronic
1013272971 6:108560029-108560051 GAAGGCGGCCGCCCGCTGCACGG - Intronic
1015793727 6:136989757-136989779 GAAAGATGTGGCCCGCAGCCTGG + Intergenic
1017417519 6:154236890-154236912 CAAGGAAAAGGCACGCTGCAGGG - Intronic
1018124621 6:160669717-160669739 CAAGGATGATGCCTACTGCATGG + Intergenic
1024701882 7:51912281-51912303 CAAGGATGAGGCAGGATGCAAGG - Intergenic
1028724758 7:94074573-94074595 GAATGATAATGTCCGCTGCAGGG + Intergenic
1029975106 7:104826403-104826425 GAAGGATGAGGGATGCTGCGTGG - Intronic
1031165724 7:118224860-118224882 GAAGAATGAGACCCGCAGCCAGG + Exonic
1034488682 7:151381576-151381598 GCGGGATCAGGCCGGCTGCAGGG + Exonic
1034717737 7:153259119-153259141 GAAGTATGAGGGTCACTGCATGG - Intergenic
1038398804 8:27267450-27267472 GAAGCTTGTGGCCCCCTGCATGG + Intergenic
1038435569 8:27533360-27533382 GAAGGAGGAGCCCCTCTCCAGGG + Intronic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1043236685 8:77877331-77877353 AAAGGATGAGGCCAGTTGGAAGG + Intergenic
1048394823 8:134003877-134003899 AAAGGATGAGTCCCTTTGCAGGG - Intergenic
1049921192 9:366038-366060 GCAGGCAGAGGCCCACTGCAGGG - Intronic
1054867667 9:70019671-70019693 GAAAGATGAAGCCCAATGCAAGG - Intergenic
1056410568 9:86322117-86322139 GAAGGATGAGGAGAGATGCAGGG - Intronic
1057527567 9:95816336-95816358 GAAGGATTTGGTCCCCTGCAAGG + Intergenic
1058308286 9:103470609-103470631 GAAGGGTGAAGCCCAATGCAAGG - Intergenic
1060774908 9:126365953-126365975 GAAGGAAGAGGGCCACTGGAGGG - Intronic
1061405644 9:130391788-130391810 GAAGGATGAGGCCCGCTGCATGG - Intronic
1061422413 9:130479547-130479569 GCAGGTTGAGGCCTGCTGCAGGG - Intronic
1061624879 9:131835720-131835742 GAAGGCGCAGGCCAGCTGCACGG + Intergenic
1195002426 X:100654919-100654941 CAGGGATGAGGCAAGCTGCAAGG - Intronic
1196601447 X:117605659-117605681 CAAGGAAGAAGCCTGCTGCACGG + Intergenic
1197600398 X:128520539-128520561 GAAGGATGAGTCCCAGTACAGGG + Intergenic