ID: 1061406505

View in Genome Browser
Species Human (GRCh38)
Location 9:130395413-130395435
Sequence CCCGCTCTGGATCTTGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061406505_1061406514 22 Left 1061406505 9:130395413-130395435 CCGGATCCAAGATCCAGAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1061406514 9:130395458-130395480 GCACTTTGCACCCTGTTCCCCGG No data
1061406505_1061406515 23 Left 1061406505 9:130395413-130395435 CCGGATCCAAGATCCAGAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1061406515 9:130395459-130395481 CACTTTGCACCCTGTTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061406505 Original CRISPR CCCGCTCTGGATCTTGGATC CGG (reversed) Intronic
900914187 1:5623181-5623203 CCCGCTCGGCATCTGGGAACAGG - Intergenic
902823987 1:18960057-18960079 CCCCCTTTGGATCTTGAATGGGG - Intergenic
903668136 1:25020599-25020621 CCGGCTCTGGAGCTTCGAGCAGG - Intergenic
905670653 1:39788446-39788468 CCCGCTCTGGCTCCTGGGCCTGG - Exonic
906099985 1:43254086-43254108 CCTGCTCTTGCTCTTGGATCTGG - Intronic
909192134 1:72566856-72566878 CTCGCTCTGGTTCTTGCATATGG - Intergenic
1064121308 10:12622395-12622417 CCAGCTCTGTATCTTGGATACGG + Intronic
1064566262 10:16641879-16641901 CCCGCTCTGCTACATGGATCAGG - Intronic
1065969786 10:30797212-30797234 CCCGCTTTGGATTTTGGAGAAGG + Intergenic
1067696551 10:48540018-48540040 CTCGCTCTGGACCTCAGATCTGG + Intronic
1082736435 11:56861022-56861044 CCAGCTCTGGAACTTTGAACGGG + Intergenic
1083353447 11:62047553-62047575 CCTGCTCTGTGGCTTGGATCCGG - Intergenic
1085862054 11:80245781-80245803 CCAGGTCTGGTTCTTGGAGCTGG - Intergenic
1094497799 12:30999741-30999763 CCTGCTCTGGATGTTGGACATGG + Intergenic
1097225641 12:57475609-57475631 CCCGCCCCGGGTCTAGGATCGGG - Exonic
1103462218 12:121113998-121114020 CCGGCTCTTGACCTTGGAGCCGG + Intergenic
1107297206 13:38921889-38921911 CCTGCTCTTGGTCCTGGATCTGG + Intergenic
1112743561 13:102502358-102502380 CCAGCTCTGGATTTTGGAAGAGG + Intergenic
1121271944 14:92643488-92643510 CCCTCCCAGGATCTTGGATGTGG + Intronic
1124886968 15:33696270-33696292 CCAGCTCTGAATCCTGGATCTGG - Exonic
1130406036 15:83602778-83602800 TGCTCTCTGGATTTTGGATCAGG + Intronic
1139261718 16:65600394-65600416 GCAGGTCTGGATCTTGGGTCAGG - Intergenic
1161583975 19:5095209-5095231 TCCGCCCTGGTTCCTGGATCAGG + Intronic
1163279503 19:16306952-16306974 CCGGCTCTGGATCTGGCACCTGG + Intergenic
1163811705 19:19436606-19436628 CCCACACTGGTTCTTGGAGCTGG + Intronic
1166026910 19:40095190-40095212 CCAGGTCTGGATATTGGATGCGG - Intergenic
929024527 2:37586980-37587002 CCCACTCTGGAATTTGCATCTGG - Intergenic
941784250 2:169480298-169480320 CCCGCCCTGGATTTTGGAGTAGG - Intronic
948608455 2:239151601-239151623 CCCTGTATGGATCATGGATCTGG - Intronic
948751856 2:240137686-240137708 CCCACCCTGGATATTGGATCGGG + Intergenic
1171328791 20:24319029-24319051 CCCACCCTGGATCCTGGACCGGG - Intergenic
1173754821 20:45506567-45506589 CCTGCCCTGGACTTTGGATCTGG - Intergenic
1175124397 20:56740671-56740693 CCCTCTCTGGCTGTGGGATCTGG - Intergenic
1178699745 21:34823017-34823039 AGCTCTCTGGGTCTTGGATCTGG + Intronic
1178783449 21:35629230-35629252 CCAGCTCAGGATCTAGGAGCAGG - Intronic
1184638214 22:45852850-45852872 CCAGCTCTGGGTCTTGCATAAGG - Intergenic
950011852 3:9729665-9729687 GCTGCTCTGGAGCTGGGATCGGG - Exonic
950447762 3:13048001-13048023 CCAGCTCTGGATCTGGGCCCAGG + Intronic
951284282 3:20790445-20790467 CCGGCTCTCAGTCTTGGATCTGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
959423556 3:106157227-106157249 CCTGCATTGGATCTTGGAACAGG - Intergenic
963028675 3:140944311-140944333 CCAGCACTGGACCTTGGTTCTGG + Intronic
963796021 3:149631742-149631764 GCCTCTCTTGATCTTGGATCTGG - Intronic
966475039 3:180335084-180335106 CCAGCACAGGATCTTGCATCTGG + Intergenic
971050156 4:22852860-22852882 GCTGCTCTGGATCTTGGATATGG - Intergenic
979367113 4:119838659-119838681 ACCATTCTGGATGTTGGATCTGG - Intergenic
981854094 4:149266804-149266826 ACCGCTGAGGACCTTGGATCAGG - Intergenic
982544083 4:156711040-156711062 CCAGCTCTGAATGTTGGCTCAGG + Intergenic
985515669 5:343608-343630 CCTGCTCTGGAGCCTGGCTCAGG - Intronic
986611407 5:9571471-9571493 CCCACTCTGGATGTGGGATGTGG + Intergenic
990989752 5:61673484-61673506 CCTGGGCTGGATCTTGGAGCAGG - Intronic
1003311655 6:4974261-4974283 CCGGTTCTGGCTCTTGGCTCCGG + Intergenic
1005207351 6:23420261-23420283 CCCGCTCTTGGTCCTGGGTCTGG - Intergenic
1006942565 6:37762719-37762741 CCTGCTCTATGTCTTGGATCAGG - Intergenic
1007851574 6:44807891-44807913 CCTGCCCTGGTTCTGGGATCAGG + Intergenic
1012023155 6:93951963-93951985 CCAGTTCTGCATCTTGGATTTGG - Intergenic
1014892140 6:126855696-126855718 CCTGCTCAGGATTTTGAATCTGG - Intergenic
1019202095 6:170326316-170326338 CCAGCTCTGTATCTTGGCTGTGG - Intronic
1024996964 7:55279477-55279499 CCCAGGCTGGATCTCGGATCTGG + Intergenic
1025073799 7:55925188-55925210 CCCACTCTGGCTCTTTGCTCTGG + Intronic
1031957610 7:127958162-127958184 GCTGATCTGAATCTTGGATCTGG - Intronic
1034113163 7:148557899-148557921 CCTGCTCTTGATCCTGGGTCTGG + Intergenic
1039898177 8:41731023-41731045 CTGGCTATGGATCTTGGTTCGGG + Intronic
1048871115 8:138800088-138800110 CCTGCTCTGGAACTGGGAGCTGG + Intronic
1050191475 9:3031012-3031034 ACCTCTCAGGATCTTGAATCAGG - Intergenic
1053450094 9:38186522-38186544 CTAGCTCTGAATCTTGGTTCAGG - Intergenic
1056100783 9:83298765-83298787 CTCCCTCTGGATCTTGGAACTGG + Exonic
1060069323 9:120532662-120532684 CCAGCTCTGGATTTTTGCTCAGG - Intronic
1061406505 9:130395413-130395435 CCCGCTCTGGATCTTGGATCCGG - Intronic
1062106245 9:134756589-134756611 CCCGCCCGGGCTCCTGGATCTGG + Intronic
1062138428 9:134942173-134942195 CCCGCTCTGCCCCTTGGAGCAGG + Intergenic
1062180078 9:135186599-135186621 CCTGCTCTGGACTCTGGATCGGG - Intergenic
1062600865 9:137318096-137318118 CCCAGGCTGGATCTTGGGTCTGG + Intronic
1195881156 X:109593877-109593899 CCCGCTCTAGTCCTTGGAACTGG - Intergenic
1199549305 X:149041054-149041076 CCCTCCCAGGATCTTGCATCTGG + Intergenic