ID: 1061408055

View in Genome Browser
Species Human (GRCh38)
Location 9:130403489-130403511
Sequence CAGGAGAAGGGTTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1493
Summary {0: 1, 1: 0, 2: 16, 3: 140, 4: 1336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061408055_1061408075 27 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408075 9:130403539-130403561 CACTCGGTGGCTGAGGTGGGAGG No data
1061408055_1061408069 14 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408069 9:130403526-130403548 GATGCCATCCGAGCACTCGGTGG No data
1061408055_1061408073 23 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408073 9:130403535-130403557 CGAGCACTCGGTGGCTGAGGTGG No data
1061408055_1061408071 20 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408071 9:130403532-130403554 ATCCGAGCACTCGGTGGCTGAGG No data
1061408055_1061408074 24 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408074 9:130403536-130403558 GAGCACTCGGTGGCTGAGGTGGG No data
1061408055_1061408068 11 Left 1061408055 9:130403489-130403511 CCCCCTCCCCAACCCTTCTCCTG 0: 1
1: 0
2: 16
3: 140
4: 1336
Right 1061408068 9:130403523-130403545 TGAGATGCCATCCGAGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061408055 Original CRISPR CAGGAGAAGGGTTGGGGAGG GGG (reversed) Intronic
900097853 1:947626-947648 CAGGAGTGGGGTGGAGGAGGGGG - Intronic
900118797 1:1039968-1039990 CTGGGGAAGAGTTGGGGAGAGGG + Intronic
900183460 1:1322545-1322567 GAGGGGTAGGGTGGGGGAGGGGG + Intronic
900548996 1:3244315-3244337 CATTAGGAGGGATGGGGAGGTGG + Intronic
900581895 1:3413513-3413535 CAGGGCTAGGCTTGGGGAGGGGG + Intronic
900839647 1:5038008-5038030 CAGGAGATGGGAGGAGGAGGAGG - Intergenic
900929729 1:5729016-5729038 CAGGGGTGGGGATGGGGAGGCGG - Intergenic
901061814 1:6475220-6475242 GGGGAGGAGGGTTGGGAAGGAGG - Intronic
901061830 1:6475257-6475279 GGGGAGGAGGGTTGGGAAGGAGG - Intronic
901195555 1:7438085-7438107 CAGGAGTAGGGGTGTAGAGGCGG + Intronic
901295376 1:8157099-8157121 CAGAGGAAGGTGTGGGGAGGGGG - Intergenic
901403982 1:9033829-9033851 CAGAAAGGGGGTTGGGGAGGAGG - Intergenic
901440183 1:9273029-9273051 CAGCAGAAGGGGAGGGGATGCGG + Intergenic
901501665 1:9656141-9656163 CAGGAGTAGGGTGGGGGAGGAGG + Intronic
901524003 1:9807899-9807921 CCAGAGAAGGGTTGTGAAGGAGG - Intronic
901735054 1:11306903-11306925 TAGGAGCAGGGGTGGGCAGGTGG - Intergenic
901881127 1:12194395-12194417 CTGGAGAATGGTTGGGATGGTGG + Intronic
902114045 1:14106573-14106595 CAGGAGTTTGGATGGGGAGGAGG - Intergenic
902275028 1:15333323-15333345 GAGGAGGAAGGATGGGGAGGAGG + Intronic
902388572 1:16089676-16089698 GAGGGGAAGGGAGGGGGAGGGGG + Intergenic
902512775 1:16975237-16975259 CAGGGGAGGTCTTGGGGAGGTGG + Intronic
902535626 1:17118081-17118103 CAGGAGACTGGTTGGGCAGGTGG + Intronic
902630217 1:17700393-17700415 GATGGGAAGGGCTGGGGAGGGGG + Intergenic
902713679 1:18257868-18257890 CAGGTGAAGGGTTCATGAGGGGG - Intronic
902770961 1:18645383-18645405 CAGAAAAAGGGGTGGGGCGGCGG + Intronic
902813971 1:18905489-18905511 GAGGAGAGGGGGTGGGGTGGGGG - Exonic
902838674 1:19062010-19062032 CAAGGGAAGGCTTGAGGAGGTGG - Intergenic
903007041 1:20305650-20305672 CAGGGGAAGGTTTGGAGAGGTGG + Intronic
903033801 1:20481601-20481623 GGGGAGGAGGGTTTGGGAGGAGG - Intergenic
903298388 1:22360621-22360643 CAGGAGATGGGCTGGGCAGAGGG + Intergenic
903550308 1:24153391-24153413 GGGGAGGAGGGTAGGGGAGGAGG - Intergenic
903619665 1:24688824-24688846 CAGGATAAAAGGTGGGGAGGAGG - Intergenic
903938156 1:26910891-26910913 CAGGAGAGGGGCTGGGGCAGAGG + Intronic
904046651 1:27613185-27613207 CAGGGGTAGGGCTGGGGTGGGGG - Intronic
904090404 1:27941078-27941100 CAGGACCATGGATGGGGAGGTGG - Intronic
904286669 1:29457234-29457256 CAGCAGTAAGGGTGGGGAGGAGG - Intergenic
904483087 1:30806248-30806270 CGGCAGAAGGGTTGGGGTTGGGG + Intergenic
904616677 1:31753793-31753815 CACCAGAAAGGTTGGGCAGGAGG + Intronic
904697795 1:32339981-32340003 CTGGAGCAAGGTTTGGGAGGTGG + Intergenic
904700375 1:32354439-32354461 CAGGTGTGGGGTTGGGGAGAGGG - Intronic
904994130 1:34617831-34617853 CAGGAAAGGGGTTGTGGTGGTGG - Intergenic
905587666 1:39133518-39133540 GAGGAGAAAGGATGAGGAGGAGG - Intronic
905852018 1:41281618-41281640 GAGGAGAAAGGTTGTCGAGGGGG + Intergenic
905959582 1:42032647-42032669 CAGGGGAATGGTGGGGGAGGGGG - Intronic
906224143 1:44107036-44107058 TGGGAGAGGGGGTGGGGAGGAGG + Intergenic
906628710 1:47346822-47346844 GAGGAGGAGAGATGGGGAGGGGG - Intronic
906745965 1:48222436-48222458 GAGGAGAAAGGAGGGGGAGGAGG - Intergenic
906778324 1:48549804-48549826 CAGGAGAAGGGAGGGAGAGAGGG + Intronic
907178917 1:52553101-52553123 GGGGGGAAGGGATGGGGAGGGGG + Intronic
907909151 1:58811840-58811862 CAGGAGGCTGGATGGGGAGGTGG + Intergenic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
908305147 1:62806639-62806661 AAGGAGAAAGGTGTGGGAGGAGG + Intronic
908788048 1:67754415-67754437 CAGAAGAAGGGGTGTGGTGGAGG - Intronic
908886449 1:68794886-68794908 AGACAGAAGGGTTGGGGAGGAGG - Intergenic
909096928 1:71298786-71298808 CAGGACATGGGGTGGGGTGGAGG - Intergenic
909146800 1:71944693-71944715 AAGCAGATGGGTTGGGAAGGTGG - Intronic
909263027 1:73519512-73519534 CTGGAGAATGGTTGGGGATGTGG - Intergenic
909744884 1:79082470-79082492 CAGAGGAAGGGGTGGGGAAGTGG - Intergenic
910258318 1:85272179-85272201 AAGGAGAAATGTTGAGGAGGGGG - Intronic
910670870 1:89771489-89771511 CAAGAAAGGGGTTGGAGAGGGGG + Intronic
911031736 1:93496234-93496256 GAGGAGAAGGAAGGGGGAGGTGG - Intronic
911059234 1:93733428-93733450 CAGGAGGAGGGTTGCGCTGGGGG + Intronic
911085474 1:93973934-93973956 CAGGAGAAAGCGGGGGGAGGGGG + Intergenic
911188362 1:94925928-94925950 AAGGAGAGGATTTGGGGAGGGGG + Intronic
911377477 1:97068848-97068870 CAGTAATAGGGTTAGGGAGGAGG - Intergenic
911549869 1:99265148-99265170 TAGGAGAAGGATTTGGGGGGGGG - Intronic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
912385245 1:109268221-109268243 TATGAGAAGGGTTGGGAAGAGGG - Intronic
912459527 1:109821691-109821713 GAGGAGGAGGGCTGAGGAGGAGG - Intergenic
912511584 1:110193647-110193669 CAGGGAAAGGGTTGGGGTGTAGG - Intronic
912631156 1:111247856-111247878 CTGGAAAGGGGTTGGGGTGGGGG - Intergenic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912724353 1:112045466-112045488 CTGGGCAAGGGTTGGGGATGCGG - Intergenic
912728373 1:112079174-112079196 CAGGAGAAGGGTTAGCAAGATGG - Intergenic
912877055 1:113370769-113370791 CATGTGCAGGGCTGGGGAGGTGG - Intergenic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
913169844 1:116222031-116222053 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
913609679 1:120497759-120497781 CTAGAGAAGGGTAGGGGATGAGG + Intergenic
914196787 1:145451883-145451905 GAGGAGGAGGGAGGGGGAGGGGG + Intergenic
914204143 1:145512776-145512798 CTAGAGAAGGGTAGGGGATGAGG - Intergenic
914483266 1:148085963-148085985 CTAGAGAAGGGTAGGGGATGAGG - Intergenic
914581512 1:149024085-149024107 CTAGAGAAGGGTAGGGGATGAGG - Intronic
914747958 1:150513192-150513214 CAGATGATGGGGTGGGGAGGTGG - Intronic
914859941 1:151377592-151377614 CAGGAGAAAGGCTGGAGAGAGGG - Intergenic
914870921 1:151473312-151473334 CCAGAGAAGGGCTGGGGACGTGG - Intergenic
915001619 1:152599497-152599519 CAGGGGTTGGGTTGGGGAGTGGG + Intronic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
915252124 1:154598036-154598058 CAGAAGAAGGGATGGGGATGGGG + Intronic
915287956 1:154864796-154864818 CAGGAGCATGGTGGGGGAGTGGG + Intronic
915310857 1:155005182-155005204 CTGGGGAAGGGTGGGGGAGGGGG + Intronic
915484085 1:156208024-156208046 CAGGAGGAGGGTGAGGGAAGTGG - Intronic
915519225 1:156431488-156431510 GAGGAGCAGGTTTGGGGAAGAGG + Intergenic
915571354 1:156746939-156746961 CAGGAGAAGGGGTGGGGCCCTGG + Intronic
916261222 1:162844367-162844389 CAGAAGCAGGGTTGGAGAGGGGG - Intronic
916332070 1:163628329-163628351 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
916506305 1:165430925-165430947 CAGGAAAAGCTTTGTGGAGGAGG - Intronic
916537321 1:165715728-165715750 TAGGAGCAGGGTTGGAGAAGAGG + Intergenic
916956568 1:169842797-169842819 TAGGGGAAGAGATGGGGAGGTGG - Intronic
917289798 1:173460682-173460704 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
917805904 1:178613581-178613603 CAGGAGAAGGCTGAGGGTGGAGG + Intergenic
918003859 1:180523804-180523826 AAAGAGAAAGGTTGGGGAGAGGG + Intergenic
918066005 1:181102163-181102185 GTGGAGAAGGTGTGGGGAGGAGG - Intergenic
918114415 1:181484297-181484319 AGGGAGTAGGGGTGGGGAGGGGG - Intronic
918152923 1:181814151-181814173 GAGGAGATGGGGTGGGGATGAGG - Intergenic
918344347 1:183593231-183593253 CAGGAGAAGGGGAGGGAAAGTGG - Intronic
919058069 1:192595419-192595441 GAGGAGGAGGGGTGGGGAGGAGG + Intergenic
919058082 1:192595452-192595474 GAGGAGGAGGGGTAGGGAGGAGG + Intergenic
919176720 1:194028433-194028455 GAGGGGAAGGGGAGGGGAGGGGG - Intergenic
919763353 1:201111938-201111960 GAGGAGGAGGGTGGGGGAGGAGG - Intronic
919763364 1:201111966-201111988 GACGAGGAGGGTGGGGGAGGAGG - Intronic
919805293 1:201377767-201377789 CAGGGGACGGGTGGGGCAGGGGG + Intronic
919826424 1:201506698-201506720 CAGCAGGAGGGTGAGGGAGGGGG + Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
920081629 1:203378823-203378845 CAGGGGAAGGGTGTGGGAGGGGG - Intergenic
920205105 1:204285827-204285849 AGGAAGAAGAGTTGGGGAGGAGG + Intronic
920314752 1:205069590-205069612 CGGGAGAGGGGTCAGGGAGGAGG - Intronic
921076200 1:211702057-211702079 GAGGAGCAGGTCTGGGGAGGAGG + Intergenic
921092979 1:211860443-211860465 CAAGAGAAAGGATGGGGAGGTGG + Intergenic
921292484 1:213671359-213671381 CAGGGGCTGGGGTGGGGAGGTGG + Intergenic
921397082 1:214679853-214679875 GAGGAGAAGGGGGGAGGAGGAGG - Intergenic
922094856 1:222434665-222434687 CAGAGGAAGGGCTGGGGAGAAGG - Intergenic
922236449 1:223726247-223726269 CAGAAGAAGGGAGGAGGAGGTGG - Intronic
922390797 1:225138787-225138809 AAGCAGTGGGGTTGGGGAGGGGG - Intronic
922440609 1:225652889-225652911 CGAGAGAAAGGCTGGGGAGGGGG + Exonic
922547293 1:226467382-226467404 GAGGAGAATGGATGGGAAGGAGG + Intergenic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
922722646 1:227906522-227906544 CAGGAGGAGGGAGGAGGAGGAGG - Intergenic
922727180 1:227927930-227927952 GAGGAGGAGGGTAGGGGATGAGG + Intronic
922896825 1:229107288-229107310 GAGGAGAGGGATTGGGGAGTTGG + Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923187816 1:231591028-231591050 CTGGAGAAGGGATGGGGTGGAGG - Intronic
923191378 1:231623780-231623802 CAAGATAAGGGGTGGGGAGAAGG + Intronic
923662973 1:235974724-235974746 CAGGAGAAAGCTTGATGAGGAGG - Intergenic
923793484 1:237131400-237131422 CAAGTGATGGGGTGGGGAGGGGG + Intronic
924020684 1:239778507-239778529 CAAGATAAATGTTGGGGAGGTGG - Intronic
924215676 1:241819293-241819315 AAGGAGAAGGGTTGTAGAGGTGG + Intergenic
924475750 1:244380821-244380843 CAGGAAAAGGGAGGGAGAGGTGG + Intronic
924532007 1:244901481-244901503 GAGGGGGAGGGGTGGGGAGGAGG - Intergenic
924825419 1:247533121-247533143 CAGGAGCAGGGGTGGTGAGAAGG - Intronic
1063081290 10:2770145-2770167 CGGGGGAAGGGGTGGGAAGGGGG + Intergenic
1063157857 10:3396650-3396672 GAGGAGAGGGGTGTGGGAGGTGG - Intergenic
1063385447 10:5613678-5613700 CTGGAGTAGGGCTGCGGAGGAGG - Intergenic
1063595548 10:7431899-7431921 CATGAAAAGGTTTGGGGAGATGG + Intergenic
1063877719 10:10497564-10497586 GAGATGAAGGGTTGGGGATGAGG + Intergenic
1064042786 10:11982711-11982733 CAGGAGAATCGCTTGGGAGGCGG - Intronic
1064220514 10:13436754-13436776 CAGGGGTAGGGATGAGGAGGTGG - Intergenic
1064768462 10:18698750-18698772 CAGGAGGAGGGGTGGGGGAGGGG - Intergenic
1064813774 10:19232809-19232831 AAGAAGCAGGGTTGGGGTGGGGG - Intronic
1065169278 10:23010740-23010762 GAAGAGAAGGAGTGGGGAGGGGG - Intronic
1065383244 10:25110714-25110736 CAGGAGAAGGTGTAGAGAGGAGG + Intergenic
1065488326 10:26255634-26255656 AAGGAAAAGGGGAGGGGAGGGGG + Intronic
1065755595 10:28927619-28927641 CAGGGGTAGGGTTGGGGGGATGG + Intergenic
1065920844 10:30391589-30391611 TATGAGAGAGGTTGGGGAGGAGG - Intergenic
1066061127 10:31724481-31724503 CATGACAAGGGGTTGGGAGGAGG - Intergenic
1066081271 10:31933081-31933103 CTGGAGAAGCTTTGGGGAGCTGG - Intergenic
1066271873 10:33831926-33831948 CAGTAGAAGGGTAGGGTGGGAGG + Intergenic
1066419026 10:35247157-35247179 CCTGAGAACGCTTGGGGAGGAGG + Intronic
1067062287 10:43083673-43083695 CAGGACAAGGGATGGAGAGCTGG - Intronic
1067742455 10:48905939-48905961 CAAGAGAAGGGCTGGAAAGGGGG - Intronic
1067827225 10:49585583-49585605 GAGGACAAGGGGTGGGGAGATGG + Intergenic
1067837671 10:49651612-49651634 CTGGAGAGTGGGTGGGGAGGTGG - Intronic
1068279470 10:54850434-54850456 CAGGGGAAAGGTTGGGAAGTGGG - Intronic
1068735391 10:60408415-60408437 CAGGAGGAAGGTTGGGGAGGGGG - Intronic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069935442 10:71912553-71912575 CATGATTGGGGTTGGGGAGGGGG - Intergenic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1069952010 10:72025505-72025527 CAGGATCAGGGTTGCGAAGGAGG + Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070616453 10:77973042-77973064 GGGGAGAAGGGTTCGGGAAGGGG - Intronic
1070680555 10:78446092-78446114 AAGGAGAAGGGAGGAGGAGGAGG + Intergenic
1070791632 10:79192927-79192949 CAGGAGACGAGATGGGGAGAGGG - Intronic
1070810092 10:79293284-79293306 GGAGGGAAGGGTTGGGGAGGTGG - Intronic
1070832830 10:79430789-79430811 CAGGAGAAGGGCTTTGGAGAAGG - Intronic
1071208539 10:83312047-83312069 CAGGTGCAGGGTTGGAGTGGGGG - Intergenic
1071289487 10:84177859-84177881 CAGGAGAGGGGAAGTGGAGGGGG - Intronic
1071564588 10:86665201-86665223 TAGGAGAAGGGAAGAGGAGGCGG + Intronic
1071585957 10:86821781-86821803 AAGGAGAAGAGAGGGGGAGGGGG - Intronic
1071952734 10:90723565-90723587 CAGGAGATGGGAGGGAGAGGGGG + Intergenic
1071957995 10:90779908-90779930 CAAGAAAAGGGTTGGGGATGGGG - Intronic
1072079249 10:92012179-92012201 GGGGAGAAGGGGAGGGGAGGGGG - Intronic
1072246521 10:93548540-93548562 AGAGAGAAGGGTTGGGGAAGAGG - Intergenic
1072430922 10:95369860-95369882 CAGGTGATGGGTGGGGCAGGTGG - Intronic
1072735094 10:97873816-97873838 CAGGAGAAGGGTGCGGCAGATGG - Intronic
1073307170 10:102512190-102512212 CAGCAGAAGGATTTGGGAAGAGG + Intronic
1073338262 10:102726795-102726817 CAGGTGAGGGGTCGGGGAAGGGG + Exonic
1073352409 10:102829320-102829342 CAGGAGAACAGTTAGGAAGGAGG - Intergenic
1073582750 10:104682804-104682826 CAGGAGGAAGGTTGGGATGGAGG + Intronic
1074020627 10:109578994-109579016 CAGGAGAAGTGACGGTGAGGAGG + Intergenic
1074086297 10:110210638-110210660 CAGGAGGAGGGGAGGAGAGGGGG - Intronic
1074389450 10:113044725-113044747 TAGGAGAAGGGATGGGGAGTGGG + Intronic
1074403166 10:113158393-113158415 CCTGAGAAGGGATGAGGAGGGGG + Intronic
1074782262 10:116810435-116810457 AAGGAAAAGGGCAGGGGAGGTGG - Intergenic
1074944645 10:118269659-118269681 TAGCAGGAAGGTTGGGGAGGGGG + Intergenic
1074973744 10:118564723-118564745 CATTAGGAGAGTTGGGGAGGGGG - Intergenic
1075190447 10:120302468-120302490 TAGGAGAAGGGATTTGGAGGTGG + Intergenic
1075466083 10:122651068-122651090 GAGCAGAAGAGTTGGGGAGGGGG + Intergenic
1075589036 10:123678289-123678311 TAGGAGGAGGGGTGGGGAGAAGG - Intronic
1075623973 10:123948530-123948552 ACGGAGACGGGTTGGGGAAGGGG - Intergenic
1075778264 10:125001740-125001762 CAGGAGCAGGGCTGGGGAGCCGG - Intronic
1075849475 10:125575378-125575400 GAGGGAATGGGTTGGGGAGGTGG - Intergenic
1076318858 10:129564163-129564185 AAGAAGAAGGGAGGGGGAGGGGG - Intronic
1076450178 10:130551750-130551772 GAGGAGATGTGTTGGGGAGCTGG + Intergenic
1076482895 10:130796483-130796505 AAGGAGCAGAGTTGGGGTGGGGG - Intergenic
1076629333 10:131842908-131842930 CATGGGTGGGGTTGGGGAGGAGG - Intergenic
1076828424 10:132982217-132982239 CTGGAGAAGGGAGGGAGAGGCGG + Intergenic
1076840686 10:133043781-133043803 CAGTGGGTGGGTTGGGGAGGTGG + Intergenic
1076890125 10:133279247-133279269 CAGGAGGAGGGTCGTGGAGGCGG + Exonic
1077132279 11:979020-979042 GGGGAGAAGGGTTGGGGGGCTGG + Intronic
1077210417 11:1368566-1368588 CAGGAGGAGAGATGGAGAGGCGG - Intergenic
1077312009 11:1893040-1893062 CAGGTGAATGGATGGGTAGGTGG + Intergenic
1077312048 11:1893223-1893245 CAGGTGAATGGATGGGTAGGTGG + Intergenic
1077334614 11:1997827-1997849 GAGGAGCAGGGTGAGGGAGGGGG - Intergenic
1077423012 11:2461743-2461765 CAGAGGAAGGGATGGGCAGGTGG + Intronic
1077480780 11:2813471-2813493 CAGGCGCAGGGTTGAGGAAGGGG - Intronic
1077877171 11:6318915-6318937 CGTGAGAAGGGATGGGGAAGCGG - Intergenic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078006733 11:7537825-7537847 AAGGAGAGGGATTGGGGAGTGGG - Intronic
1078148447 11:8738593-8738615 TAGCAGCAGGGATGGGGAGGAGG - Intronic
1078151204 11:8761005-8761027 GAGGAGGAGGGTTGGGAAGGAGG - Intronic
1078531366 11:12139214-12139236 CAGGAGCAGGGCAGAGGAGGAGG - Intronic
1078543753 11:12231437-12231459 GAAGAGGAGGGTTGGGGAGGGGG - Intronic
1079115283 11:17636701-17636723 CAGGAGGAGGGCTGAGGGGGAGG - Intronic
1079348184 11:19670950-19670972 GAGGAGAGGGGCTGGGGAGCTGG - Intronic
1079356922 11:19737440-19737462 AGGGAGAAGGGATGGGGAAGAGG + Intronic
1080119648 11:28662508-28662530 GAGGAGTGGGGTTGGAGAGGAGG - Intergenic
1080403673 11:31959548-31959570 CAGCAGATGGGCTGGGGAAGGGG - Intronic
1080615729 11:33943203-33943225 CAGAAGAAACTTTGGGGAGGAGG + Intergenic
1080683458 11:34496467-34496489 CAGGAGAGGGGCTGGTGAGGAGG - Intronic
1080894672 11:36439323-36439345 GAGGGCAAAGGTTGGGGAGGGGG + Intronic
1081613201 11:44575754-44575776 TGGGAGAAGGGGTGGTGAGGTGG - Intronic
1081676311 11:44972020-44972042 CAGGAGATGGGGTGGGGATGGGG + Intergenic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1082097557 11:48143785-48143807 GAGGAGAGGGGAGGGGGAGGAGG - Intronic
1082808378 11:57463927-57463949 AAGGAGGAGGGGAGGGGAGGGGG - Intronic
1083096723 11:60258438-60258460 CAGGAGAAGAGTGGGGTGGGTGG + Intergenic
1083105740 11:60356826-60356848 CAGGAGAAGGGTGGGGTGGGTGG - Intronic
1083266125 11:61547660-61547682 GGGGAGAAGGGTTGGGGATGAGG + Intronic
1083268245 11:61557107-61557129 CATGAGGAGGGCGGGGGAGGAGG - Intronic
1083318140 11:61828744-61828766 GAGGAGGAGGATTGGGGAGGGGG - Intronic
1083594132 11:63910949-63910971 TAAGTGCAGGGTTGGGGAGGAGG - Exonic
1083657168 11:64235094-64235116 CAGGGGACGGGGTGGGGCGGAGG - Intronic
1083701151 11:64478424-64478446 CAGGGGAAGGGAAGTGGAGGAGG + Intergenic
1083882566 11:65555756-65555778 CAGGAGAAGGGCTGGGGCTTTGG - Intronic
1084129011 11:67119206-67119228 CTGGAGGAGGGGTGGGGAGGTGG + Intergenic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1084238959 11:67805808-67805830 CCGGAGAAGGGCTCAGGAGGCGG + Intergenic
1084389389 11:68865342-68865364 CAGGTGTAGGGCTGGAGAGGAGG - Intergenic
1084568812 11:69947153-69947175 AATGAGATGGGTTTGGGAGGTGG - Intergenic
1084722545 11:70916653-70916675 CAGGCGAAGGGAGGGCGAGGGGG - Intronic
1084760682 11:71268747-71268769 GAGGAGAAGGGAGGAGGAGGAGG + Intergenic
1084833475 11:71787032-71787054 CAGGAGAAGCGCTCAGGAGGCGG - Intergenic
1084975973 11:72798549-72798571 CAGGAGAAGGGGTAGAAAGGCGG - Intergenic
1084980110 11:72824504-72824526 CAGGAGCAGGGTAGGGTTGGTGG - Intronic
1085020227 11:73202073-73202095 CAGGGGAAGGGGTGGGGATGAGG - Intergenic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085052225 11:73385672-73385694 GAGGAGAAGGGCTGTGGAGAAGG + Intronic
1085085573 11:73664416-73664438 AAGGGGAAGGGAGGGGGAGGGGG - Intergenic
1085270426 11:75266843-75266865 CAGAAGAAGGCTGGGGTAGGAGG + Intronic
1085296592 11:75434952-75434974 CATGAGGTGGGTTGGGGAGGAGG + Exonic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085430819 11:76445832-76445854 AAAGAAAAGGGGTGGGGAGGAGG - Intronic
1085555197 11:77413062-77413084 TAAGAGCAGGGTTTGGGAGGGGG - Intronic
1086361239 11:86062105-86062127 GAAGAGAAGGGATGGCGAGGGGG + Intronic
1086875564 11:92091528-92091550 TAGTTGAAGGGTGGGGGAGGTGG - Intergenic
1087196421 11:95308541-95308563 CAGGGGCTGGGGTGGGGAGGGGG - Intergenic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088258127 11:107920152-107920174 CATGAGAAGTGCTGGAGAGGAGG - Intronic
1088562717 11:111132087-111132109 AAGGGGAAGAGATGGGGAGGTGG + Intergenic
1089011678 11:115136801-115136823 CTCGAGAAGGGTGGGGCAGGGGG - Intergenic
1089054786 11:115576742-115576764 TAGAAGGAGGGGTGGGGAGGAGG + Intergenic
1089116152 11:116096807-116096829 TAGGGGAAAGGTTGGGTAGGAGG + Intergenic
1089307950 11:117538497-117538519 CAGGAGCTGGGTTGGAGAGCAGG + Intronic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1089659627 11:119977602-119977624 CAGGAGATATGTTGGTGAGGCGG + Intergenic
1089689124 11:120175572-120175594 CAAGGGAAGGGCTGGGGAGCAGG + Intronic
1089692495 11:120195606-120195628 CAGGAGCAGGGGCAGGGAGGGGG - Intergenic
1089772963 11:120816394-120816416 CAGGAGCTGGGTGGGGGCGGGGG + Intronic
1089821492 11:121231359-121231381 CAAGAGAAGGGATGGGTGGGAGG - Intergenic
1089849040 11:121481192-121481214 TAGGAGAGGAGCTGGGGAGGAGG - Intronic
1089849084 11:121481408-121481430 TAGGAGAGGAGCTGGGGAGGAGG - Intronic
1090240760 11:125179982-125180004 CAGGACATGAATTGGGGAGGAGG - Intronic
1090262822 11:125333840-125333862 GAGGGGAAGGGCTGGGGTGGAGG + Intronic
1090439787 11:126716001-126716023 CAGGAGAAGGGCGGAGGAAGAGG + Intronic
1090480250 11:127061518-127061540 CAGGAGACGGGTTTGGGAGCAGG - Intergenic
1090490133 11:127153322-127153344 TAGGAGAAGGAGTGGGGAGTTGG + Intergenic
1090511092 11:127376227-127376249 CAGAAGCAGGGCTGGGCAGGAGG + Intergenic
1090734556 11:129599485-129599507 CAGGAGAAGGCTTCAGAAGGTGG + Intergenic
1091124366 11:133082425-133082447 GAAGAGAAAGGATGGGGAGGGGG - Intronic
1091208179 11:133834744-133834766 CAGGAGAAGAGGCTGGGAGGTGG - Intergenic
1091226176 11:133957481-133957503 AGGGAGACGGGGTGGGGAGGCGG - Intergenic
1091304734 11:134530224-134530246 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1091304803 11:134530386-134530408 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1091304817 11:134530416-134530438 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1091304831 11:134530446-134530468 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1091304845 11:134530476-134530498 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1091304866 11:134530523-134530545 ACGGAGGAGGGTGGGGGAGGAGG - Intergenic
1202817597 11_KI270721v1_random:53009-53031 GAGGAGCAGGGTGAGGGAGGGGG - Intergenic
1091586764 12:1821254-1821276 CAGAGGAAGGCTTGGGGTGGAGG + Intronic
1091603103 12:1929843-1929865 GAGGAGAAGGAAGGGGGAGGAGG + Intergenic
1091624752 12:2113392-2113414 CAAGATAAGAGTTGGGGAGGTGG + Intronic
1091910587 12:4227318-4227340 CAGGAGAGGGGCTGCTGAGGTGG - Intergenic
1092152581 12:6261083-6261105 CAGGAGGAGGTTTGGGGGTGAGG + Intergenic
1092157705 12:6295173-6295195 CAGCAGCAGGGTTGGGGGGTGGG - Intergenic
1092670409 12:10855074-10855096 CAGGAGAAGGACTGGGTGGGGGG - Intronic
1092817294 12:12323030-12323052 GAGGAGAGGGGGAGGGGAGGGGG + Intergenic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1092915181 12:13183001-13183023 GTGGAGAAGAGGTGGGGAGGAGG + Intergenic
1092955221 12:13543278-13543300 TAGGAGGTGGGTTGGAGAGGTGG - Exonic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1094155293 12:27332553-27332575 CGGGGCTAGGGTTGGGGAGGAGG - Intergenic
1094375254 12:29783128-29783150 CAGGCGAAGGGGTGCGGAGGCGG + Intronic
1095494223 12:42768053-42768075 CTGGAGAGGGGTTGTGGAAGAGG + Intergenic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1095951093 12:47782430-47782452 CAGGAGTGGGGGTGGGGTGGGGG - Exonic
1096204582 12:49710128-49710150 GAGGAGTAGGTTTGGTGAGGGGG + Intronic
1096264021 12:50109838-50109860 GTGGAGAAGGGTTGGGGGAGAGG + Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096666866 12:53171814-53171836 CAAGAGAACGGTGGGGGAGGAGG + Intronic
1096669380 12:53189452-53189474 GAGGGGTGGGGTTGGGGAGGGGG + Exonic
1096677769 12:53234696-53234718 CAGGAGGAGGCTTGGGAAGAGGG + Intergenic
1096902513 12:54900011-54900033 CAGGAGAAAGGTGGCGGTGGGGG + Intergenic
1096981065 12:55728519-55728541 CAGGAGAGGGGTGGGGGCGACGG + Intronic
1097181395 12:57173995-57174017 CAGGAGAAGGGTAGGGAGGGTGG + Intronic
1097233649 12:57526286-57526308 GAGGAGAGGGTTGGGGGAGGAGG - Exonic
1097262023 12:57725688-57725710 CAGGGGGTGGGTTGGGGTGGGGG - Intronic
1097526419 12:60741549-60741571 CAGGAAAAGAATTGGGGAGAGGG - Intergenic
1097867516 12:64571122-64571144 CAGGAGAATTGCTTGGGAGGTGG + Intergenic
1097959229 12:65516180-65516202 CAGCAGAAGTGATGGGAAGGTGG - Intergenic
1098572648 12:72006377-72006399 AAGGAACAGGGTTGGGGAGGTGG + Intronic
1099207564 12:79745784-79745806 GATGAGAAGGGTTGGGGAGGAGG + Intergenic
1099455180 12:82854456-82854478 AAGGAGGAGGGTAGGGGTGGAGG + Intronic
1099893696 12:88619258-88619280 CATGAGAAGGGTTGGAGAGGTGG - Intergenic
1100177796 12:92050649-92050671 CTGGGGAAGGGTTGGGGGGATGG + Intronic
1100325233 12:93533924-93533946 GTGTAGAAGGGTTGAGGAGGAGG + Intergenic
1100872425 12:98924019-98924041 CAAGGGAAGGGTTGGGCATGTGG + Intronic
1101027859 12:100631158-100631180 CAGGTGAAGAGTTGGGATGGGGG - Intergenic
1101333693 12:103777850-103777872 CAGGAGAGGGGTTCCGAAGGTGG + Exonic
1101843101 12:108341937-108341959 GAGGAGAGGGGAGGGGGAGGAGG + Intergenic
1101845299 12:108358666-108358688 AAAGAGAAGGGCTGGGGAGGGGG + Intergenic
1102016413 12:109650886-109650908 CAGGAGGAGGGATGGGGATTGGG - Intergenic
1102042711 12:109810816-109810838 CTGGGGTAGGGGTGGGGAGGAGG + Intronic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102408535 12:112695985-112696007 CAGGGGAAAAGTTTGGGAGGGGG - Intronic
1102457541 12:113080041-113080063 CAGGAGGAGGGTTGGCATGGAGG + Intronic
1102652025 12:114448812-114448834 AAGGATGGGGGTTGGGGAGGCGG - Intergenic
1102687585 12:114736471-114736493 CAGGAGAAGCGCTTCGGAGGAGG + Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1103073909 12:117967307-117967329 GAGGAAAGGGGTCGGGGAGGAGG - Intronic
1103425576 12:120830508-120830530 GAGGGGGAGGGGTGGGGAGGGGG + Intronic
1103623186 12:122201019-122201041 CAGGTCACGGGATGGGGAGGAGG + Intronic
1103724746 12:122992060-122992082 CAGGAGATGCGTTGGGGCAGGGG - Intronic
1103920286 12:124395744-124395766 CACGAGAAGGGATGGAGAGGCGG + Intronic
1104052229 12:125203228-125203250 CAGGGGAAGGGATGGGGACAAGG - Intronic
1104107426 12:125676490-125676512 CAGCAGAAGGCTAGGGGAGCTGG + Intergenic
1104544477 12:129698674-129698696 GAGGAGATGGGGAGGGGAGGGGG + Intronic
1104844704 12:131840931-131840953 CAGCCGCAGGGTTGGGGATGGGG - Intronic
1104952579 12:132448407-132448429 CAGAACGAGGGCTGGGGAGGAGG - Intergenic
1105007290 12:132729423-132729445 GAGGGGAGGGGTAGGGGAGGGGG + Intronic
1105028761 12:132868413-132868435 CAGGAGAATGGCGTGGGAGGCGG + Intronic
1105069607 12:133226687-133226709 CAGGAGCTGGGCTGGAGAGGAGG - Intronic
1105661331 13:22498544-22498566 GAGGAGACGGGGTGGGAAGGGGG + Intergenic
1105810918 13:23994469-23994491 AAGCAGAGGTGTTGGGGAGGAGG + Intronic
1105859328 13:24395246-24395268 GAGGAGAGGGGTTGGAGCGGGGG - Intergenic
1106227977 13:27799354-27799376 CAAGAGAAGGGTGGTGGTGGCGG + Intergenic
1106247641 13:27962780-27962802 GAAGAGAAGAGCTGGGGAGGAGG + Exonic
1106407529 13:29486988-29487010 CAGGTGAGGGGTAGGGGAGGGGG + Intronic
1106415639 13:29543743-29543765 GAGGAAGAGGGGTGGGGAGGAGG + Intronic
1106806192 13:33309838-33309860 CAAGAGAGGGATTGGGGATGGGG + Intronic
1106925277 13:34606878-34606900 GAGGATGAGGGTCGGGGAGGGGG + Intergenic
1106929480 13:34648301-34648323 GAAGAGATGGGTTGGGGAGATGG + Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1108128784 13:47274365-47274387 CAGGAGAAGCTTTGGGGGGTTGG + Intergenic
1108156387 13:47589698-47589720 CAGGAAAAGGGATGGGGAGTTGG + Intergenic
1108159060 13:47618908-47618930 CAGCGGAAGGGATGGGGAGTTGG - Intergenic
1108458770 13:50644024-50644046 CAGGAGCAGGTTTTGGGAGTGGG - Intronic
1108750131 13:53439885-53439907 GAGGGGGAGGGATGGGGAGGGGG - Intergenic
1109233545 13:59788226-59788248 TTGGTGAAGGGTTGGGGAAGAGG + Intronic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1111589364 13:90323637-90323659 CAGGAGAGGAGTGGGGGTGGGGG + Intergenic
1112584472 13:100706012-100706034 CAGGAGCAGGGGTGGAGATGCGG - Intergenic
1112966025 13:105195419-105195441 CAGGAGATGGGGTGAGGACGAGG - Intergenic
1113463993 13:110501436-110501458 CAGGAGAAAGGCTGGGGTGGGGG + Intronic
1113708230 13:112447553-112447575 CAGGAGAAGCCCTGGGCAGGAGG + Intergenic
1113779344 13:112967164-112967186 GAGGGGCAGGGTTGGGGTGGGGG + Intronic
1113796386 13:113061103-113061125 TGAGAGAAGGGCTGGGGAGGGGG + Intronic
1113920839 13:113908433-113908455 GAGAAGAAAGGTGGGGGAGGAGG - Intergenic
1113927946 13:113951618-113951640 CTGGAGGAGGCTTGGGGAGCAGG - Intergenic
1113936617 13:113998261-113998283 GAAGAGAAGGGTTGGGAAGAGGG - Intronic
1114270011 14:21094714-21094736 GAGGATAGGGGTTGGGGGGGGGG + Intronic
1114528555 14:23381112-23381134 CAGGTGAACGGTTAAGGAGGCGG + Intergenic
1114530508 14:23392656-23392678 CAGGAGAAGGGTGGGGGTGGGGG + Intronic
1114836670 14:26211231-26211253 GAGGTGCAGGGTTGGGGTGGGGG - Intergenic
1115018860 14:28650272-28650294 CAAGAGAAGGGTTGAGGGGATGG - Intergenic
1115045358 14:28986045-28986067 CTGGATGAGGTTTGGGGAGGGGG + Intergenic
1115498274 14:34027413-34027435 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1115783441 14:36797001-36797023 CAGGAGATGGGTTAAGGTGGAGG + Intronic
1116765217 14:49062240-49062262 CAGGAAAGGAGTTGGGGAGAAGG + Intergenic
1116875455 14:50107005-50107027 CAGGAGGAGGCTGGGTGAGGTGG - Intergenic
1116948396 14:50857112-50857134 CAGGAGCTGGGTTGGAAAGGTGG - Intergenic
1117397626 14:55326519-55326541 GAGGAGCAGGTTTGGTGAGGAGG + Intronic
1117649068 14:57883039-57883061 GAGGAGAAGGGGAGGGGAGGAGG + Intronic
1118320340 14:64748988-64749010 CAGGAGGAGGGTGGGAGAGGAGG + Exonic
1118363128 14:65072432-65072454 CAGGATGAAGGTGGGGGAGGCGG - Intronic
1118405023 14:65413532-65413554 AAGGAGAAGGGTTGGGGGCGGGG + Intronic
1118619190 14:67599468-67599490 TTGGGGAAGGGTTTGGGAGGAGG + Intronic
1118702228 14:68444745-68444767 TAGGAGCAGGGATGGGGTGGAGG + Intronic
1118768109 14:68923472-68923494 CTGGGGAAGGGTAGTGGAGGAGG + Intronic
1118900403 14:69981072-69981094 CAGAAGGAGGCTGGGGGAGGAGG + Intronic
1119223924 14:72929588-72929610 CAGGAAGAGGGCAGGGGAGGGGG + Intronic
1119397666 14:74339462-74339484 AAAGAGAAGGGTGGAGGAGGGGG + Intronic
1119411309 14:74432566-74432588 AAGGAGAAGGTTAGGTGAGGTGG + Intergenic
1119471844 14:74905466-74905488 CAGGGGAAGGGGTGGGGTCGGGG - Exonic
1119620981 14:76131619-76131641 CAAGAGGAGGGGTGGGCAGGAGG + Intergenic
1119779614 14:77269494-77269516 CAGTAGAAGGCATGAGGAGGAGG - Intronic
1119899281 14:78245867-78245889 TGGGAGAAGGGGTGGGGAAGAGG + Intronic
1120325106 14:83014046-83014068 CAGAAGAAGGGAAGGGGAGAGGG + Intergenic
1120420880 14:84284318-84284340 GAGGAGAGGGGATGGGAAGGGGG + Intergenic
1121050482 14:90816429-90816451 CTGGGGAAGGGGCGGGGAGGCGG + Intronic
1121086561 14:91150957-91150979 CAGGAGATGGGGTGGGGAATGGG - Intronic
1121495367 14:94388458-94388480 CAGGAGGGGGGTTGTGGAGTGGG - Intronic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121586566 14:95067087-95067109 CAGGAGCTGAGATGGGGAGGAGG - Intergenic
1121675175 14:95746536-95746558 CAGGGGAGGGGTTGGGGTGCTGG + Intergenic
1121777075 14:96598140-96598162 CAGGAGAAAGGGAGAGGAGGGGG - Intergenic
1121908113 14:97766032-97766054 CACCAGGAGGGTTTGGGAGGCGG - Intergenic
1121908888 14:97771117-97771139 CAGAACCAGGCTTGGGGAGGGGG + Intergenic
1122035547 14:98946697-98946719 CAGGAGTGGGGTGGGGGTGGGGG - Intergenic
1122292820 14:100688597-100688619 CAGGACTTGGGTGGGGGAGGAGG + Intergenic
1122329897 14:100904919-100904941 AAAGAGAAGAGTGGGGGAGGAGG + Intergenic
1123076852 14:105671711-105671733 TGAGAGAAAGGTTGGGGAGGTGG + Intergenic
1202918067 14_KI270723v1_random:3295-3317 CAGGGGCAGGGCAGGGGAGGAGG - Intergenic
1202926558 14_KI270724v1_random:31291-31313 CAGGGGCAGGGCAGGGGAGGAGG + Intergenic
1123433536 15:20238131-20238153 CAGGAGAATAATTTGGGAGGTGG - Intergenic
1123539252 15:21271700-21271722 GAGGAGGAGGGTGGGGGAGAGGG - Intergenic
1123909351 15:24951314-24951336 AATGACAAGGGTTGTGGAGGAGG - Intronic
1123921813 15:25075465-25075487 CAGGAGAAGGGTTTTTGAGTTGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124226691 15:27901302-27901324 CAGCAGCAGGGCTGGGGAGAAGG - Intronic
1124347050 15:28930060-28930082 AAGGAGCTGAGTTGGGGAGGTGG + Intronic
1124553757 15:30707311-30707333 AAGGAGAAGAGCTGGGGTGGAGG + Intronic
1124587636 15:31024384-31024406 GAGGAGAAGGCTTGAGGAGAAGG - Intronic
1124613698 15:31226090-31226112 GTGGAGAAGGGTTGGGGGGGAGG + Intergenic
1124677491 15:31698363-31698385 AAGGAGAAGAGCTGGGGTGGAGG - Intronic
1125024802 15:35019494-35019516 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1125024811 15:35019513-35019535 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125318261 15:38455088-38455110 CAGGAGCTGACTTGGGGAGGAGG - Intronic
1125601540 15:40918329-40918351 CAGGGCATGGGGTGGGGAGGGGG + Intergenic
1125719622 15:41839076-41839098 GAGGAGGAGGCTTGGGGATGAGG + Intronic
1126473954 15:49046576-49046598 AAGGAAAAGGAGTGGGGAGGAGG + Intergenic
1126814584 15:52442254-52442276 CAGGAGATGGCTGGTGGAGGTGG - Intronic
1127334718 15:57972264-57972286 CAGGAGAAGGTCTGGAGAAGAGG - Intronic
1127352858 15:58170270-58170292 GAGGAAAAGGGCTGGAGAGGAGG - Intronic
1127488948 15:59443933-59443955 CATGAGAAGGGGTGGAGACGGGG - Intronic
1127546312 15:59996963-59996985 AATGAGAAGGGGTGGGGAGAGGG + Intergenic
1127674843 15:61229022-61229044 CTGGAGAGGGGCTGGGGAGGGGG - Intronic
1128095282 15:64949578-64949600 CAGGAGAAGGCCTGGGGCTGGGG + Intronic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128233162 15:66049324-66049346 CAGGAAAAGGGTTGGGGTAGGGG + Intronic
1128326947 15:66729906-66729928 CCGCAGAAGGGGCGGGGAGGGGG + Intronic
1128336794 15:66791815-66791837 AATGAGAAGGATTGGAGAGGTGG + Intergenic
1128589078 15:68878596-68878618 CAGGAGGAAGGTTGGGAGGGGGG - Intronic
1128704988 15:69832201-69832223 CAGGAGAAAGGCAGGGGAAGGGG + Intergenic
1128711808 15:69877887-69877909 GGGGAGAAGGACTGGGGAGGGGG - Intergenic
1128754266 15:70170751-70170773 TAGGAGAAAGGCTAGGGAGGAGG + Intergenic
1128886164 15:71290003-71290025 CTGGGGAAGGGTAGGTGAGGAGG - Intronic
1129005165 15:72366751-72366773 CAGGAGGGTGGTTGAGGAGGAGG - Intronic
1129288941 15:74548517-74548539 AAGGGGAAGGGTAGAGGAGGGGG - Intronic
1129360100 15:75019305-75019327 CAGGTGGAGGGTGGGGGTGGGGG - Exonic
1129380340 15:75161102-75161124 CATGAGGAGGGCTGGGGAAGTGG + Intergenic
1129451209 15:75652285-75652307 CAGGAGTAGGGCAGGGGAGGTGG + Intronic
1129465481 15:75722156-75722178 CAGGAGTTGGGGTGGGGTGGAGG + Intergenic
1129490858 15:75924220-75924242 GAGGAGGAGGGCCGGGGAGGAGG + Intronic
1129657471 15:77533750-77533772 CTGGGGAAGGGAAGGGGAGGAGG - Intergenic
1129904035 15:79173335-79173357 CAGGACACGGGATGGGGATGAGG + Intergenic
1130012568 15:80163045-80163067 CAGGAGCTGGGTTAGGGACGGGG + Intronic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1130064438 15:80592569-80592591 CAGGAGAGGGGCTTGGGATGAGG - Intronic
1130316545 15:82801433-82801455 TGGTAGACGGGTTGGGGAGGTGG + Intronic
1130688831 15:86062671-86062693 CAGGAGAAGGAAAGAGGAGGAGG - Intergenic
1130843457 15:87723304-87723326 CAGGTGAGGGTTGGGGGAGGGGG - Intergenic
1130862300 15:87901747-87901769 AAGGAGGAAAGTTGGGGAGGGGG + Intronic
1130880459 15:88051214-88051236 GAGGTGTAGGGTTGGGCAGGTGG - Intronic
1131071841 15:89471042-89471064 GAAGGGAAGGGATGGGGAGGAGG + Intergenic
1131105690 15:89732782-89732804 CTGGAGAGGAATTGGGGAGGGGG - Intronic
1131229031 15:90647035-90647057 GAGGAGGAGGGTTGAGGAGGAGG - Intergenic
1131229035 15:90647048-90647070 GAGGAGGAGGGGTGAGGAGGAGG - Intergenic
1131229077 15:90647196-90647218 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229086 15:90647225-90647247 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229094 15:90647251-90647273 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229102 15:90647277-90647299 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229111 15:90647306-90647328 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229120 15:90647335-90647357 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229128 15:90647361-90647383 GAGGAGGAGGGGTGTGGAGGAGG - Intergenic
1131229142 15:90647403-90647425 GAGGAGAAGGGGTGAGGGGGAGG - Intergenic
1131229190 15:90647531-90647553 GAGGAGAAGGGGTGAGGAGGAGG - Intergenic
1131229199 15:90647562-90647584 GAGCAGGAGGGTTGAGGAGGAGG - Intergenic
1131229231 15:90647648-90647670 GAGGAGGAGGGGTGAGGAGGAGG - Intergenic
1131229237 15:90647664-90647686 GAGGAGGAGGGGTGAGGAGGAGG - Intergenic
1131229249 15:90647696-90647718 CAGGAGGAGGGGTGAGGAGAAGG - Intergenic
1131833226 15:96367341-96367363 CAAGATGGGGGTTGGGGAGGTGG - Intergenic
1131862646 15:96670569-96670591 CAGCAGAAGGAGTTGGGAGGAGG + Intergenic
1132079428 15:98852036-98852058 AAGGTGGAGGGTTGGGGTGGAGG + Intronic
1132294668 15:100726352-100726374 CAGGGGCTGGGTTGGGGTGGGGG + Intergenic
1132657568 16:1047812-1047834 CAGGAGCAGGGGCGGGAAGGAGG - Intergenic
1132752889 16:1466989-1467011 CAGGACGATGGTTGGGGAAGGGG - Intronic
1132789285 16:1676277-1676299 GGGGAGATGGGTTAGGGAGGAGG + Exonic
1133035425 16:3031367-3031389 CGGGGCAAGGGTTGGGGTGGGGG + Intronic
1133114001 16:3565603-3565625 GGGGCCAAGGGTTGGGGAGGAGG + Intronic
1133129947 16:3670862-3670884 CAGGAGCAGGTCTGGGGAGATGG - Intronic
1133148534 16:3808668-3808690 AAGGAGAGGGGATGGGGAAGTGG + Intronic
1133295864 16:4751975-4751997 CAGGAGAGGGGTTGGGACGTGGG + Exonic
1133333070 16:4988123-4988145 CAAGGGAAGGGGCGGGGAGGCGG - Intronic
1133392614 16:5422282-5422304 GAGGAGAAGGGAGGGAGAGGAGG + Intergenic
1133417312 16:5616630-5616652 GAGGAGGAGGGGTGAGGAGGAGG - Intergenic
1133848919 16:9483487-9483509 CAGGAGAGTGGTGGAGGAGGTGG + Intergenic
1133856205 16:9551453-9551475 AAGGAGAAGGGAAGAGGAGGAGG - Intergenic
1134023360 16:10937183-10937205 CAGGAGCAGAGCTGGAGAGGTGG + Intronic
1134224387 16:12380337-12380359 CAGGTGAAGGGATGGGTGGGTGG - Intronic
1134236735 16:12472231-12472253 CAGGGGAAGGCTGGGGGTGGTGG + Intronic
1134291228 16:12903758-12903780 CGGAAGAAGGGGTGGGGAGAGGG - Intronic
1134592206 16:15463732-15463754 CAGGAGCTGGGGTGGGGATGGGG - Intronic
1134635567 16:15789278-15789300 CAGAAGAAGGGCAGGGGAAGGGG + Intronic
1134641643 16:15833841-15833863 AAGGAAAGGGGTTGGGGTGGGGG - Intronic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134860146 16:17553612-17553634 AAGGAGAAGGGATGGGTAGATGG + Intergenic
1134993647 16:18722486-18722508 GAGGAGAGGAGATGGGGAGGGGG + Intergenic
1135126876 16:19818090-19818112 GAGGCGAAGGGCAGGGGAGGAGG - Intronic
1135277904 16:21129143-21129165 TAGGAGAGGAGATGGGGAGGGGG - Intronic
1135280067 16:21146723-21146745 GAGTGGAAGGGTTGGGGAGATGG - Intronic
1135407249 16:22207044-22207066 CAGGGGAAAGGTGGGGGATGCGG - Intronic
1135529082 16:23237239-23237261 AAGGAGAAGGGAAGGGAAGGAGG - Intergenic
1135587180 16:23679907-23679929 CTGGAGAAGGAATGGGGTGGGGG + Intronic
1136168199 16:28470613-28470635 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1136610566 16:31362779-31362801 GAGGATGAGGGTAGGGGAGGTGG + Intronic
1136627279 16:31469562-31469584 CAAGAGAGGGGGTGGGGTGGGGG - Intergenic
1136851089 16:33612998-33613020 CAGGAGAATAGTTTGGGAGGTGG + Intergenic
1137026952 16:35486303-35486325 CAGGGCCAGGGTAGGGGAGGAGG - Intergenic
1137033165 16:35543839-35543861 CAGGGGAAGAGCAGGGGAGGAGG - Intergenic
1137565266 16:49528761-49528783 CAGGGGGAGGGCCGGGGAGGTGG + Intronic
1137619499 16:49867146-49867168 CAGGAGAAGGTTTGGAGTGCAGG - Intergenic
1137689691 16:50414353-50414375 AAGGGAAAGGGTTGGTGAGGAGG - Intergenic
1137756965 16:50910136-50910158 CAGGAGAAGACTTGGGGAAAGGG - Intergenic
1138091011 16:54174579-54174601 CAGCAGAGGGCTTGGGGAGGGGG + Intergenic
1138092410 16:54186578-54186600 CTGGAAAAGAGGTGGGGAGGAGG + Intergenic
1138229560 16:55327249-55327271 CAGGAGTACAGTTGGGGAGGGGG - Intronic
1138497710 16:57418297-57418319 CAGGGGTGGGGTGGGGGAGGAGG - Intergenic
1138509757 16:57501613-57501635 CTGGAGATGGGCTTGGGAGGAGG + Intergenic
1138620967 16:58211056-58211078 GAGGAGGATGGTTGGGAAGGTGG + Intergenic
1138667732 16:58586331-58586353 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1139136049 16:64206159-64206181 CAGCTGCAGGGTTGGGGGGGTGG + Intergenic
1139261476 16:65598697-65598719 CAGGCCTAGGGTTGGGGTGGGGG + Intergenic
1139425007 16:66873908-66873930 GAGGAGAAGGGAGGAGGAGGGGG - Intergenic
1139701384 16:68710102-68710124 CAGGAGATGGGGCGGGAAGGAGG + Intronic
1139806017 16:69566060-69566082 CAGGAGAGGGGTTCAGGACGGGG - Exonic
1140306377 16:73806807-73806829 CTGGAGAGGGCTTGGGGAGATGG - Intergenic
1140376160 16:74446938-74446960 CAGCAGAAGGCTCAGGGAGGAGG + Intergenic
1140520001 16:75572657-75572679 CAGTGGAGGGGTTGGGGAGAGGG + Intronic
1140529337 16:75650214-75650236 GAGTGTAAGGGTTGGGGAGGAGG + Intronic
1140788309 16:78364942-78364964 CAGAAGAAAGGTTGGGGACCAGG - Intronic
1140857728 16:78992609-78992631 CATGGGAAGGGATGGGGAGCTGG - Intronic
1141091457 16:81133191-81133213 CAGAAGAAAAGCTGGGGAGGAGG + Intergenic
1141109051 16:81257156-81257178 CAGGAGAAGCTTCAGGGAGGAGG - Intronic
1141585184 16:85028616-85028638 CAGGACAAGGGCGGGGGTGGGGG - Intronic
1141697078 16:85625196-85625218 CAGATGAAGGGCTGGAGAGGAGG - Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1141831069 16:86510273-86510295 GAGGAGAGAGGTGGGGGAGGCGG + Intergenic
1141996320 16:87638554-87638576 GAGGACAAGGGTTAGGTAGGAGG + Intronic
1142002599 16:87672021-87672043 CAGGTGTAGGGCTGGGCAGGTGG + Intronic
1142112559 16:88340108-88340130 GAGGAGAAGGGGTGGTGAGGGGG - Intergenic
1142186775 16:88698445-88698467 CAGGAGGAGGGTGGATGAGGAGG + Intronic
1142290668 16:89192490-89192512 CAGGGGACGGCCTGGGGAGGAGG - Intronic
1142292843 16:89200756-89200778 CGTGAGAAGAGATGGGGAGGCGG - Intronic
1203112691 16_KI270728v1_random:1461458-1461480 CAGGAGAATAGTTTGGGAGGTGG + Intergenic
1142532204 17:587972-587994 TGGGAGGAGGCTTGGGGAGGTGG - Intronic
1142787201 17:2233639-2233661 AAGGAGGGGGGTTGGGGAGAGGG - Intronic
1142978576 17:3658986-3659008 GAGGGGAAGGTTTGGGGAAGTGG + Intronic
1143129157 17:4665243-4665265 CAAGGGCAGGGATGGGGAGGTGG - Intergenic
1143180662 17:4982165-4982187 CAGGAGACAGGCTGGGGTGGGGG + Intronic
1143282742 17:5766931-5766953 CAGGAAAAAGGATAGGGAGGTGG - Intergenic
1143317788 17:6045830-6045852 CAGGAGGAGGGTTGGCAAGGAGG - Intronic
1143374367 17:6458613-6458635 GCGGAGAAGTGGTGGGGAGGGGG - Intronic
1143544986 17:7590428-7590450 CAGGAAAGGGGTTGGGGTGGTGG - Intronic
1144025336 17:11272056-11272078 GAGGAGATGGGCTGAGGAGGAGG - Intronic
1144461584 17:15463005-15463027 CAGGAGATGGGGGTGGGAGGAGG + Intronic
1144644571 17:16963397-16963419 AAGGAGCAGGGTTGGGGCGATGG + Intronic
1144664855 17:17095534-17095556 CAGCAGAAGGGCTTGGGATGAGG + Intronic
1144706388 17:17371136-17371158 GAGGAGTAAGCTTGGGGAGGAGG - Intergenic
1144783497 17:17819505-17819527 CTGGCCAGGGGTTGGGGAGGGGG - Intronic
1144953525 17:19006077-19006099 CTGCAGAAGTGTTGGGGTGGTGG - Intronic
1145276997 17:21437499-21437521 CAGGAGCAGGGTTGAGGCTGAGG - Intergenic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145794925 17:27649911-27649933 GAGGAGGTGGCTTGGGGAGGGGG + Intergenic
1145809419 17:27755629-27755651 GAGGAGGTGGCTTGGGGAGGGGG + Intergenic
1146000207 17:29126298-29126320 GAGGAGGAGGGACGGGGAGGAGG + Intronic
1146632354 17:34479868-34479890 TAGGAGAGTGCTTGGGGAGGAGG - Intergenic
1146809329 17:35890744-35890766 CAGAAGAGGGGAGGGGGAGGGGG - Intergenic
1146943779 17:36860725-36860747 CAGCAGAAAGGCTGGAGAGGTGG + Intergenic
1146954434 17:36928993-36929015 AGTGGGAAGGGTTGGGGAGGAGG - Intergenic
1147194945 17:38760264-38760286 CAGGAGAAGGGAGAGGGAGCTGG + Intronic
1147325534 17:39667863-39667885 CTGGAGGAGGGGCGGGGAGGGGG + Intergenic
1147337390 17:39735793-39735815 CAGGTCTGGGGTTGGGGAGGAGG - Intergenic
1147400229 17:40176651-40176673 CAGAAGGAGTGTGGGGGAGGAGG - Intergenic
1147612659 17:41811095-41811117 CAGGAGGAGGCTTGTAGAGGAGG - Intronic
1147754627 17:42760621-42760643 CGGGAGAAGGTCTGGGGAGTGGG - Intronic
1147862864 17:43533807-43533829 TAGGAGAAGGGTTCCAGAGGAGG - Intronic
1148017407 17:44531793-44531815 CTGGGGAATGGTGGGGGAGGAGG + Intergenic
1148020175 17:44548156-44548178 CAGGAAAGGGGAAGGGGAGGGGG + Intergenic
1148323981 17:46772778-46772800 CAGGTGAAGGGGTGGGGTGCTGG - Intronic
1148444074 17:47727210-47727232 CAGGAGTTGGGCTGGGGAGGCGG - Intergenic
1148553926 17:48566540-48566562 ATGGAAAAGGGTTGGGGAGGAGG + Intronic
1148624043 17:49055345-49055367 CAGGAATAGGGTGGGGGATGGGG - Exonic
1148653113 17:49263855-49263877 CAGTAGAAAGGATGGGGCGGGGG - Intergenic
1148676561 17:49448898-49448920 AGGGAGAAGGGGTGAGGAGGTGG + Intronic
1148863971 17:50619048-50619070 CAGGAGAAGGGTGTGGAGGGTGG + Intronic
1148900041 17:50868009-50868031 TAGGAGAAGGGGTGGGAAGATGG + Intergenic
1148956680 17:51360001-51360023 CAGCAGAAGGGTTAGGAAGAAGG - Intergenic
1149496622 17:57122381-57122403 AGGGAGAAGGGTGGGTGAGGTGG + Intergenic
1149534426 17:57421525-57421547 GAGGAGAATGAATGGGGAGGAGG - Intronic
1149537238 17:57442532-57442554 CGGGAGAAGGGGAGGGGAGATGG - Intronic
1150442495 17:65202809-65202831 GGGGAGGAGTGTTGGGGAGGGGG - Intronic
1150807267 17:68329270-68329292 CGGGAGAGAGCTTGGGGAGGAGG + Intronic
1150964184 17:69948501-69948523 GAGGAGAGGGGAGGGGGAGGGGG + Intergenic
1151072171 17:71227163-71227185 TAAGAGAAGGGTAGGGGATGAGG + Intergenic
1151163244 17:72183454-72183476 CAGGAGAAGGGATGGGCAAAAGG + Intergenic
1151361712 17:73593107-73593129 CAGGAGCTGGGGTGGGGAGGAGG - Intronic
1151506571 17:74531650-74531672 CTGCAGAAGGGGTGGGGTGGGGG + Intergenic
1151520970 17:74629307-74629329 AAGAAGAAGTGGTGGGGAGGGGG + Intergenic
1151758344 17:76087334-76087356 CGAGAGAAGGATTTGGGAGGGGG + Intronic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1152007009 17:77688626-77688648 GAGGGGAAGGCTGGGGGAGGTGG - Intergenic
1152226344 17:79094555-79094577 TGGGAGGAGGGTGGGGGAGGGGG + Intronic
1152266320 17:79296982-79297004 AAGAAGAGGGGATGGGGAGGAGG - Intronic
1152277584 17:79367223-79367245 AGGGAGAAGGGGAGGGGAGGAGG - Intronic
1152302848 17:79505497-79505519 CAGAAGAGGAGCTGGGGAGGTGG - Intronic
1152596396 17:81239701-81239723 GAGGGGAAGGGCTGGGAAGGGGG - Intronic
1152898869 17:82928705-82928727 CTGGGGAAGAGATGGGGAGGGGG - Intronic
1152903472 17:82958133-82958155 CAGGAGCAGGGTTGAGGGAGAGG - Intronic
1153229191 18:2920439-2920461 TAAGAGAAAGGTTGGGGAAGAGG + Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153620072 18:6969002-6969024 CAGGAGAAGGGGTGCAGTGGGGG + Intronic
1153682638 18:7515045-7515067 AAGGAAAAGGGGTGGGGGGGGGG - Intergenic
1153733781 18:8043650-8043672 AGGGAAGAGGGTTGGGGAGGTGG - Intronic
1153847382 18:9062275-9062297 CAGTAGAAGGGTTGGGGAAGAGG - Intergenic
1153979890 18:10299770-10299792 CAAGAGATGGTGTGGGGAGGGGG + Intergenic
1154031354 18:10756631-10756653 GAGGAGGAGGGGTGGGGATGAGG + Intronic
1154031539 18:10757513-10757535 GAGGAGGAGGGATGGGGATGAGG + Intronic
1154197815 18:12279230-12279252 CAGGAGAGGAGGTGAGGAGGAGG + Intergenic
1155037421 18:22036735-22036757 CAGGAGAAGGCTGGGCGTGGTGG + Intergenic
1155179789 18:23334404-23334426 CAGGAGAAGGGTTGAAGGGGAGG - Intronic
1156770004 18:40708719-40708741 TAGGGGAAGGGGTGGGCAGGGGG + Intergenic
1156849346 18:41708113-41708135 CAGAAAAAGGGGTGGGGAGGGGG + Intergenic
1156987093 18:43361395-43361417 AAGGAGAAGGGGTGGGAGGGAGG - Intergenic
1157007774 18:43606465-43606487 CAGAACCAGTGTTGGGGAGGTGG + Intergenic
1157299275 18:46467919-46467941 CAGGTGTGTGGTTGGGGAGGGGG - Intergenic
1157544679 18:48539448-48539470 CAGGAGCAGGGATGGGGGGAAGG - Intronic
1157592256 18:48842981-48843003 AAGCAGAAGGGTAGGGCAGGGGG - Intronic
1157919332 18:51698895-51698917 TAGGAGCAGGGTTGGGCATGAGG - Intergenic
1158142447 18:54269703-54269725 AATGAGAAGGGTGGGGCAGGCGG + Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610400 18:58935198-58935220 GAGGAGAAGGAGAGGGGAGGAGG - Intronic
1159154104 18:64559743-64559765 CATCAGAGGGGTTGGTGAGGAGG - Intergenic
1159591108 18:70336164-70336186 CAAGAGTGGGGGTGGGGAGGTGG + Intronic
1160063423 18:75552070-75552092 GAGGAGAAGGGGGTGGGAGGAGG + Intergenic
1160135333 18:76266468-76266490 AAGGAGAAGGGAAGGGAAGGGGG + Intergenic
1160251919 18:77210387-77210409 CAGGAGTGGGGGTGGGGAGGTGG + Intergenic
1160447245 18:78937178-78937200 CAGGAGATGAGCTGGGAAGGTGG + Intergenic
1160448581 18:78946837-78946859 GAGGAGAAGGGGAGAGGAGGAGG + Intergenic
1160659157 19:290514-290536 CAGGAAACACGTTGGGGAGGAGG + Intronic
1160709983 19:547043-547065 CTGGAGAGGGGATTGGGAGGTGG + Intronic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160819775 19:1052514-1052536 GAGGAGAAGGGGGGAGGAGGAGG + Intronic
1160919198 19:1511969-1511991 CTGGAGCAGGGAAGGGGAGGAGG + Intronic
1160965292 19:1744675-1744697 AGGAAGAAGGGATGGGGAGGAGG - Intergenic
1161086863 19:2339457-2339479 CAGGTGCAGGGCTGGGCAGGTGG + Intronic
1161338153 19:3725742-3725764 CAGAAGGAGCCTTGGGGAGGTGG - Intronic
1161352833 19:3803435-3803457 CAGATGCAGGGTGGGGGAGGAGG - Intergenic
1161378228 19:3950836-3950858 CAGGGGTTGGGGTGGGGAGGGGG + Intergenic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1161576718 19:5058456-5058478 CAGGAGCAGGGGCGGGAAGGGGG + Intronic
1161873831 19:6891975-6891997 CAGGAGATGAGATGGGGAGGTGG + Intronic
1161932255 19:7348914-7348936 GAGGAGGAGGGGTGGGGAGCTGG - Intergenic
1161942612 19:7415197-7415219 CAGGAGCAGGGTTAGGGAGGTGG - Intronic
1162099312 19:8330272-8330294 CAGGGGAAGGTCTGGAGAGGTGG + Intronic
1162140109 19:8580524-8580546 GAAGAGTAGGGGTGGGGAGGTGG - Exonic
1162327873 19:10009476-10009498 CAGCAGCTGGGGTGGGGAGGGGG + Intronic
1162768861 19:12937370-12937392 CAGGAAAGAGGGTGGGGAGGGGG - Intergenic
1162806629 19:13140636-13140658 GGGGAGAAGGGTCGGGCAGGGGG + Exonic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163085784 19:14979237-14979259 GAGGCCACGGGTTGGGGAGGTGG + Intronic
1163235671 19:16029111-16029133 AAGGGGAAGGGGAGGGGAGGGGG + Intergenic
1163464001 19:17455670-17455692 CGGGGGAGGGGGTGGGGAGGAGG - Exonic
1163513528 19:17749454-17749476 CAGGAGGAGGGAGGGGAAGGGGG + Intronic
1163520379 19:17788243-17788265 GAGGGGGAGGGGTGGGGAGGAGG - Intronic
1163664207 19:18595362-18595384 CAGGATAGGGGCTGGGGAGCTGG + Intronic
1163695274 19:18760651-18760673 CTGGAGACGGGTGGGGGTGGTGG - Intronic
1164524136 19:29001088-29001110 GGGGAGAGGGGTGGGGGAGGTGG + Intergenic
1164563474 19:29309856-29309878 CAGGACAAGGGTAGGGGCTGGGG - Intergenic
1164712453 19:30367173-30367195 CAGCAGAAGGGATGTGGCGGAGG - Intronic
1164743573 19:30594722-30594744 CAGGAGAAGAGTGGGGAGGGAGG - Intronic
1164844996 19:31424535-31424557 CAGGAGAGGGGTGGGGAAGAAGG - Intergenic
1165026492 19:32966370-32966392 CTGGAGATGGGTTGGGGCTGCGG + Exonic
1165217230 19:34284215-34284237 CAGGAGAATCGCTTGGGAGGTGG - Intronic
1165796787 19:38524280-38524302 ACGGAGCATGGTTGGGGAGGGGG + Intronic
1165899387 19:39161750-39161772 CTGGAGCAGGGTGGGCGAGGGGG - Intronic
1166034579 19:40158431-40158453 CAGTAGAAAGGGTGGGGAGTGGG - Intergenic
1166075402 19:40411198-40411220 CAGGAGCTGGGTTGGGCAGGAGG + Intronic
1166300309 19:41908959-41908981 CAAGAGAAGAGATGGGGAAGGGG - Intronic
1166373992 19:42316788-42316810 CAGGGGCAGGGTTGGGGGGCTGG + Intronic
1166521282 19:43481904-43481926 AATGAGAAGGATTAGGGAGGAGG + Intronic
1166656542 19:44616120-44616142 CAGGACAAGCGTAGGGGTGGAGG + Intronic
1166695344 19:44848603-44848625 GAGGCGAAGGATTGGGGTGGGGG - Intronic
1166744022 19:45131363-45131385 GAGGGGAAGGGCTGGGGCGGAGG - Intronic
1166778600 19:45327738-45327760 TGGGAGATGGGTTGGGGAAGTGG - Intergenic
1166783280 19:45353200-45353222 GTGGAGAGGGGTCGGGGAGGTGG - Intronic
1166804295 19:45475960-45475982 AATGAGATGGGTTGGGGTGGGGG - Intronic
1166878880 19:45914720-45914742 CAGGAGAGGGGCTGGGGCTGGGG + Exonic
1167011831 19:46813679-46813701 GAGGAGAAGGGTGGAGGTGGAGG - Intergenic
1167373740 19:49100387-49100409 GAGGAGATGGGGTGGGGTGGAGG - Intronic
1167406201 19:49310288-49310310 CAGGAGGAGGGTTGGGATGGCGG + Intronic
1167566623 19:50261280-50261302 GGGGAGAAGTGATGGGGAGGGGG - Intronic
1167586964 19:50380767-50380789 AAGGAGATGGGGTGGAGAGGAGG + Intronic
1167605644 19:50480257-50480279 CAGGACCAGGGTAGGGGATGAGG - Intronic
1167729491 19:51243126-51243148 CAGGAGAAGGGAGGAGGAGGAGG - Intronic
1167930263 19:52857780-52857802 CCGGAGAACGGGTTGGGAGGAGG - Intergenic
1168152913 19:54458612-54458634 CAGGACAAGGGTTGGGGGCTGGG - Intronic
1168295795 19:55376909-55376931 CAGGTGAGGGGCTGGTGAGGCGG + Exonic
1168434418 19:56305970-56305992 CAGGAGAAGGGGGAGGGAGTGGG + Intronic
925070751 2:965202-965224 CAGGAGGAGGATTGGGGACCAGG - Intronic
925070807 2:965357-965379 CAGGAGGAGGATTGGGGACCAGG - Intronic
925146634 2:1587076-1587098 AAGGAGAAGGAATGTGGAGGTGG + Intergenic
925292389 2:2756384-2756406 CAGGGAAGGGGTTGGGGAGACGG - Intergenic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925680276 2:6413133-6413155 CAAGAAAAGGGGAGGGGAGGGGG + Intergenic
925896209 2:8474210-8474232 CAGGTGAGGGGTTAGGGAGGAGG - Intergenic
926025333 2:9537934-9537956 GAGGAGAGGGGAAGGGGAGGGGG + Intronic
926086141 2:10021570-10021592 GAGGAGGGAGGTTGGGGAGGAGG - Intergenic
926332345 2:11835984-11836006 CAGGAGGGGTGTGGGGGAGGGGG - Intergenic
926337433 2:11875108-11875130 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926337443 2:11875127-11875149 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926337453 2:11875146-11875168 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926928270 2:18010309-18010331 CAGCAGCAGTGTTGGGGAGATGG + Intronic
927080345 2:19622170-19622192 CAGGAGAAAGGGTGGGAAGCAGG + Intergenic
927229559 2:20808569-20808591 CAGGAGAATCGCTTGGGAGGCGG + Intronic
927683364 2:25154621-25154643 CAGGAGAAGCCGGGGGGAGGGGG + Exonic
927852645 2:26510095-26510117 CAGGAGAAGGGTCCTGCAGGTGG - Intronic
928174365 2:29024028-29024050 CAGGGGAAGGGTGGGGGTGGAGG + Intronic
928178787 2:29053190-29053212 CTGGGGAAGGGCAGGGGAGGGGG - Exonic
928964772 2:36966135-36966157 CGCGAGAAGGCTGGGGGAGGGGG + Intronic
929031026 2:37649834-37649856 CAAGAAAAGGGTTGGTGGGGAGG + Intronic
929045618 2:37786113-37786135 CAGGTGAAGGTGTGGGGAGTTGG + Intergenic
929188543 2:39120261-39120283 CTGGGGAAGGGCTGGGGAGGCGG - Intronic
929366770 2:41167786-41167808 CAGGAGAAGGGTTTGAAAGCTGG + Intergenic
929430247 2:41880273-41880295 CAGAAGAGGGGTTGGGGGAGTGG - Intergenic
929434632 2:41919178-41919200 GAGGAGATGGGGTGGGGATGAGG - Intergenic
929460087 2:42097055-42097077 GTGGGGAAGGGTTAGGGAGGAGG - Intergenic
929617060 2:43319509-43319531 CAGGAGGGAGGTCGGGGAGGTGG - Intronic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929662607 2:43803537-43803559 CAGGGGAGGGGTCGGGAAGGAGG + Intronic
929783983 2:44976003-44976025 CTGGAGAAGGGGTAGAGAGGCGG - Intergenic
929879133 2:45821392-45821414 CAGGAGGATGGTGGGGGTGGAGG + Intronic
929987339 2:46747676-46747698 AATTAGAAGGGTTGGGGATGTGG - Intronic
930279569 2:49354292-49354314 AAGGAAAAGAGTTGGGGAAGGGG - Intergenic
930374753 2:50551096-50551118 GAGGAGGAGGGAGGGGGAGGGGG + Intronic
930476862 2:51892475-51892497 CAGAAGTAGGGTTCAGGAGGGGG + Intergenic
931062360 2:58545521-58545543 GGGGAGAAGGGTTGTGGTGGTGG + Intergenic
931282680 2:60807921-60807943 CAGGTGAAAGCTGGGGGAGGTGG + Intergenic
931356115 2:61538555-61538577 GAGGAGAGGGGTGGAGGAGGAGG + Intronic
931487234 2:62705755-62705777 GAGGAGAAAGGCGGGGGAGGGGG + Intronic
931732507 2:65165574-65165596 CAGGAGAAGACTTGGCCAGGGGG + Intergenic
931752389 2:65341333-65341355 CAGGAAAAGGGGTGGGGAAATGG + Intronic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932086977 2:68771298-68771320 CAGGCGGAGGGTTGGAGAGGGGG - Intronic
932177194 2:69613734-69613756 TAGGACAAGGGATGGGGAAGGGG - Intronic
932534771 2:72581672-72581694 CAGGGGCAGGGTGCGGGAGGTGG - Intronic
932785599 2:74599330-74599352 CATGACAAGGGTTGGGGAAGAGG - Intronic
932892444 2:75608857-75608879 GAGGAGAAGGGGCGGGGAGGAGG + Intergenic
933270955 2:80232428-80232450 AAGGAGAAGGGTGGGGAAAGAGG - Intronic
933523371 2:83403878-83403900 GAGGGGAAAGGTTGGGAAGGGGG + Intergenic
933975354 2:87504882-87504904 CAGGAGAGGGGGTGGGCATGGGG + Intergenic
934652345 2:96099814-96099836 GAAGAGAAGGGGAGGGGAGGAGG + Intergenic
934716141 2:96545558-96545580 CAGCAGCAGGGTTTGAGAGGAGG + Intronic
934765094 2:96876116-96876138 GAGGAGAGGGGTCGGGGCGGTGG + Exonic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935054338 2:99552635-99552657 CTGGGGCAGGGATGGGGAGGTGG + Intronic
935949309 2:108314453-108314475 CAGGAGCAGGCTTGGTGAGGCGG + Intergenic
936041137 2:109150297-109150319 GAGGGGAAGGGTTGGGGGAGGGG + Intronic
936318472 2:111445931-111445953 CAGGAGAGGGGGTGGGCATGGGG - Intergenic
936502795 2:113079468-113079490 CAGGAGCAGGGTGGGTGGGGAGG + Intergenic
936614576 2:114035428-114035450 CAGGAGAAAGGGTGGGAGGGGGG - Intergenic
936679814 2:114757212-114757234 CAGGAGGAAGGGTGGGGAAGAGG + Intronic
936696656 2:114957942-114957964 CCGGAGAAGGATTGGGAAAGGGG + Intronic
936851162 2:116899845-116899867 AAGGGGAAAGGTTGGGAAGGGGG - Intergenic
937100375 2:119263884-119263906 CAGCAGGAGGCCTGGGGAGGAGG + Exonic
937164081 2:119795422-119795444 CAGGAGAAAGGCCGAGGAGGGGG - Intronic
937249394 2:120514052-120514074 CAGGAAAAGGGTTAGGGGTGGGG - Intergenic
937283026 2:120733397-120733419 CAGCAGAAGGTTTGGAGTGGAGG - Intergenic
937288911 2:120770241-120770263 CAGGAGGAGGCTGGGGGTGGGGG - Intronic
937363870 2:121246975-121246997 GAGGAGAAACGTTGGGCAGGTGG + Intronic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
937680661 2:124640818-124640840 CAGGTGAAGGGTTAGGAAGGAGG + Intronic
937880664 2:126862111-126862133 CACGAGGAGGCTGGGGGAGGAGG - Intergenic
938043443 2:128095490-128095512 CAGGAGGAGAGTGGGGGAGGAGG - Intronic
938203095 2:129392947-129392969 CTGGGGAAGGGTTGGGGAAGGGG + Intergenic
938628390 2:133137495-133137517 GAGGAGAAGGGTGGGGTAGAGGG + Intronic
938725592 2:134106165-134106187 CAGCTGAAGGGGTGGGGTGGGGG - Intergenic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939487653 2:142835817-142835839 CAGGAACAGTTTTGGGGAGGCGG - Intergenic
939512052 2:143119470-143119492 GAGGGGAAAGGATGGGGAGGGGG - Intronic
939591862 2:144074210-144074232 TAGGAGCAGGGTTGAGAAGGAGG + Intronic
939669847 2:144996954-144996976 TTGGAGAAGGGTTGGGGTGGGGG + Intergenic
939698916 2:145364070-145364092 CAGGAGAAGGGCTTGGGCCGGGG + Intergenic
939914298 2:148020896-148020918 CAGGAGCGGGGGCGGGGAGGAGG - Intronic
940181331 2:150936877-150936899 AAGGAGAAAAGTTGGGGAGAAGG - Intergenic
940804351 2:158169207-158169229 GAGCACAAGGGTTGGGGAGGAGG + Intergenic
940809961 2:158231325-158231347 CAGGAGAAGATTTGAGGAGGTGG - Intronic
940851897 2:158695445-158695467 AAGCAGAAGTGTTGGGAAGGAGG + Intergenic
941219921 2:162765057-162765079 CAGGAGAAGGGTAAGGAAGGAGG + Intronic
941831691 2:169968346-169968368 GCTGGGAAGGGTTGGGGAGGAGG - Intronic
941965002 2:171292311-171292333 CAGGAGAATTGCTTGGGAGGTGG - Intergenic
942043228 2:172084653-172084675 GTGGAGAAGGGAGGGGGAGGAGG + Intergenic
942143494 2:173001747-173001769 CAGGAGCGAGGTGGGGGAGGTGG + Intronic
942236555 2:173914298-173914320 GAGGAGGGGAGTTGGGGAGGGGG - Intronic
942487320 2:176453068-176453090 CAGGAGAAGGTGTGGTAAGGAGG + Intergenic
943150514 2:184106855-184106877 AAGAAGAAAGGTTGGGAAGGAGG + Intergenic
944101143 2:196029374-196029396 CAGGGCAAGGGTGGGTGAGGAGG + Intronic
944191635 2:197010037-197010059 CAGGAGCAGGATGGAGGAGGAGG + Intronic
944212642 2:197222267-197222289 GAGGAGGAGGGTAGGGAAGGAGG + Intronic
944221438 2:197308498-197308520 AAGGAGATGGGGTGGGGAAGTGG - Intronic
944782985 2:203039341-203039363 AAGGAGAAGGGGAGGGGAGGGGG - Intronic
945048248 2:205800478-205800500 AAGGAGAAGGGCTGGAGATGGGG + Intergenic
945680046 2:212903065-212903087 AAGGAGAAAGGGTGGGAAGGGGG - Intergenic
945965748 2:216184872-216184894 CAGAAGAAGGGAGGGTGAGGAGG - Intronic
946029053 2:216690862-216690884 CAGCAGAAAGGTGGGGGAGGGGG + Intronic
946146512 2:217735218-217735240 CAGGAGGTGAGTGGGGGAGGGGG - Intronic
946153343 2:217790779-217790801 AAGGAGAAGGGAAGGAGAGGAGG - Intergenic
946431691 2:219629813-219629835 GAGGAGCAGGGTGTGGGAGGGGG + Intronic
946497904 2:220214500-220214522 GAGGGTAAGGGTTGGGGAAGAGG - Intergenic
946898299 2:224346962-224346984 CAGTAGATGGTTTGGGGTGGAGG - Intergenic
947013972 2:225597291-225597313 CAGGAGAAAGGGTGGGAGGGGGG - Intronic
947418511 2:229921806-229921828 CAGCTGAGGGGTTGGGGGGGCGG - Intronic
947745685 2:232506257-232506279 CCGGAGAGGGCTTGGGAAGGGGG + Intergenic
947903908 2:233745746-233745768 AAGCAGAAGGGGTGGAGAGGAGG + Intronic
947942451 2:234070151-234070173 GAGGAGAAGTCTTGGGAAGGAGG - Intronic
948366130 2:237455982-237456004 CTGTAGAAGAGTTGGGGTGGTGG + Intergenic
948422761 2:237870701-237870723 CAGGACCAAGGCTGGGGAGGAGG + Intronic
948772364 2:240258204-240258226 CTGGAGCAGGGCTTGGGAGGTGG + Intergenic
948846345 2:240684484-240684506 CAGTGGACGGGTTGGGGAGGGGG - Intergenic
948847517 2:240690249-240690271 CAGTGGATGGGTTGGGGAGGGGG + Intergenic
949041776 2:241852928-241852950 CACGAGCAGGGCTGGGGAGAAGG + Exonic
1168859454 20:1035485-1035507 CAGGATGGGGGTTGGGGACGTGG + Intergenic
1169064396 20:2686173-2686195 TAGGAGGAGGGTGGGGGAGTGGG - Intergenic
1169367184 20:5001238-5001260 CGGGAGATGGGTCGGGGTGGGGG + Intronic
1169507237 20:6224643-6224665 CAGGATAAGGGTAGGGGCGTTGG - Intergenic
1169603648 20:7290879-7290901 CACGAGATGGGGTGTGGAGGGGG + Intergenic
1170215455 20:13886145-13886167 CAGGAGTAGGGTGAGAGAGGAGG + Intronic
1170664707 20:18376290-18376312 CGGGAGACGGGAGGGGGAGGGGG + Intergenic
1171121265 20:22571211-22571233 AGGGAGAAGGGCTGGGGTGGGGG + Intergenic
1171865219 20:30484348-30484370 TCGGAGGAGTGTTGGGGAGGAGG + Intergenic
1172029977 20:31975032-31975054 CAGGAGAAGCTCTGGGGAGTGGG + Intronic
1172138221 20:32702432-32702454 GAGGAGGAGGGTAGTGGAGGAGG + Intergenic
1172414908 20:34757463-34757485 CAGGAGACTTGTTGGTGAGGTGG + Exonic
1172520917 20:35564959-35564981 CAGGAGGTGGTCTGGGGAGGAGG + Intergenic
1172775335 20:37403672-37403694 CAGGAGAAGGGCTGGGGCCGGGG + Exonic
1172901116 20:38335538-38335560 AAAGAGAAGGGCAGGGGAGGAGG - Intronic
1173123550 20:40316093-40316115 CAAGAGAAGGGTTGGGATGGAGG + Intergenic
1173166229 20:40688936-40688958 GCGGAGAAGAGCTGGGGAGGCGG + Exonic
1173338790 20:42135821-42135843 CAGGAGAAGGTATAGGGATGAGG + Intronic
1173602755 20:44307730-44307752 CAGGGGTGGGGTAGGGGAGGAGG - Intronic
1173614107 20:44391424-44391446 CAGGACAAGAGGTGAGGAGGGGG - Intronic
1173645752 20:44632161-44632183 CAGCAGAAGCCTTGGGGTGGGGG + Intronic
1173708773 20:45136219-45136241 CATGGGAAGGGTAGGGCAGGGGG - Intergenic
1173852012 20:46224719-46224741 CAGGACTAGGTTGGGGGAGGAGG - Intronic
1173866143 20:46313729-46313751 CAGGAGCGGGGTTAGGGAGCTGG - Intergenic
1174508695 20:51034696-51034718 TAGGAGAAGCATGGGGGAGGGGG - Intergenic
1174527587 20:51186009-51186031 CAGGTAAGGGGTTGGGGAAGGGG + Intergenic
1174606940 20:51768165-51768187 CTGGGGCAGGGCTGGGGAGGCGG - Intronic
1174956442 20:55103842-55103864 CAGGGGAAGGGGTGGGGTGTAGG + Intergenic
1175031335 20:55957553-55957575 GAGGAGAAGGGTGGGGGTGGGGG - Intergenic
1175232395 20:57482102-57482124 AAGGAGAAGGGGAGGAGAGGGGG + Intergenic
1175332067 20:58172022-58172044 CTGAAGGATGGTTGGGGAGGTGG - Intergenic
1175497402 20:59424141-59424163 CCAGTGGAGGGTTGGGGAGGGGG + Intergenic
1175498903 20:59435467-59435489 GAGGTGAAGAGGTGGGGAGGTGG - Intergenic
1175552421 20:59826161-59826183 GAGGACAAGGTATGGGGAGGAGG + Intronic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175743333 20:61435956-61435978 CTGGAGAAGGCGAGGGGAGGTGG - Intronic
1175863917 20:62164401-62164423 CAGGAGCAAGGTAGGGGATGGGG + Intronic
1175873959 20:62220725-62220747 GAGGAGAAGGGATGGGGAGGAGG + Intergenic
1176048475 20:63104584-63104606 TGGGAGAAGAGCTGGGGAGGAGG - Intergenic
1176342440 21:5710726-5710748 GAGGAGAAGGGTCGGGGCTGAGG - Intergenic
1176474694 21:7142878-7142900 GAGGAGAAGGGTCGGGGCTGAGG - Intergenic
1176502387 21:7613730-7613752 GAGGAGAAGGGTCGGGGCTGAGG + Intergenic
1176536761 21:8108795-8108817 GAGGAGAAGGGTCGGGGCTGAGG - Intergenic
1176999727 21:15597334-15597356 CAGGGGAAAGGATGGGAAGGGGG - Intergenic
1177688544 21:24472381-24472403 AAGGAGGAGGGTTGGAGAAGTGG - Intergenic
1177758256 21:25373572-25373594 GAGGAGGAGGGGTGGGGAGCAGG - Intergenic
1177758317 21:25373721-25373743 GAGGAGGAGGGGAGGGGAGGGGG - Intergenic
1177938950 21:27385377-27385399 CAGGAGAATCGCTGGGGAGGCGG - Intergenic
1178274698 21:31226433-31226455 CAGAACTAGGGTTGGGGAAGTGG + Intronic
1178358921 21:31932209-31932231 CAGGAGCAGTGCTGGGGAAGTGG - Intronic
1178687719 21:34724273-34724295 GTGGAGAAGGGGTGGGGAAGGGG + Intergenic
1178724825 21:35042205-35042227 CAGGAGAAGGGATGAGGTGGGGG - Intronic
1178931384 21:36821537-36821559 GAGCAGGAGGTTTGGGGAGGAGG - Intronic
1179150593 21:38805708-38805730 CAGCAGGAGGGTTGGGGGAGCGG - Intronic
1179155958 21:38851517-38851539 CTGGAGCAGGGATGGGGAAGGGG + Intergenic
1179299690 21:40095527-40095549 CAGGGGCAGGGTAGGGGAAGGGG + Intronic
1179488605 21:41726577-41726599 AAGAAGAAGGGGGGGGGAGGAGG - Intergenic
1179514964 21:41899931-41899953 GGGGAGAAAGTTTGGGGAGGAGG + Intronic
1179639954 21:42741061-42741083 CTGGGGAAGGGTTGGGCATGCGG - Intronic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179875086 21:44263046-44263068 CAGGTGGGGGGTTGGGGAGCTGG + Intergenic
1180971231 22:19816882-19816904 AAGAAGCAGGGTTGGGGGGGTGG - Intronic
1181086211 22:20440634-20440656 GAGGAGAGGGGATGGGGACGGGG - Intronic
1181094849 22:20497851-20497873 CAGGAGATGGGTGGGGAAGTAGG + Intronic
1181305735 22:21916366-21916388 CTGGGGAAGGGGTGGGGAGCTGG - Intergenic
1181824562 22:25504649-25504671 CAGGAGCATGTTTGGGGAGAAGG - Intergenic
1181858805 22:25802253-25802275 CAGGGCAAGGGATGGGGAGAGGG + Intronic
1181998793 22:26903612-26903634 GAGGGAAAGGGCTGGGGAGGGGG + Intergenic
1182249976 22:28992414-28992436 ATGGAGAAGAGTTGAGGAGGGGG - Intronic
1182583382 22:31328542-31328564 AAGGAGGAGGGCTGGGGAAGAGG + Intronic
1182931473 22:34178299-34178321 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1183249696 22:36721497-36721519 CTGGAGAGAGGCTGGGGAGGAGG + Intergenic
1183329027 22:37209466-37209488 CTGATGAAGGGTTGGGGAGAAGG - Intronic
1183495309 22:38139953-38139975 CAGCAGATGGGGAGGGGAGGAGG + Intronic
1183603913 22:38857673-38857695 CAGGAGATGGGCGTGGGAGGTGG - Intergenic
1183735773 22:39644034-39644056 CTGGAGGAGGGATGGGGAGGTGG + Intronic
1183777040 22:39972973-39972995 CAGGAGGAGGGCTGGGCAGTGGG + Exonic
1183792461 22:40083877-40083899 GCAGGGAAGGGTTGGGGAGGAGG + Intronic
1183812157 22:40266412-40266434 AAGGATCAGGGGTGGGGAGGTGG + Exonic
1183912959 22:41092475-41092497 CAGGAGGAGGGTTCGGAGGGTGG + Exonic
1184085945 22:42264277-42264299 CGGGGGCAGGGTGGGGGAGGGGG + Intronic
1184286008 22:43471882-43471904 CAAGAGGAGGGTCAGGGAGGTGG + Intronic
1184409209 22:44317056-44317078 CAGGTCAGGGGTTGGGGAGCTGG - Intergenic
1184427522 22:44421714-44421736 GAGGGGAAGGGATGGGAAGGGGG - Intergenic
1184596951 22:45519772-45519794 AAGGACAAGGGCTGGGGAGGTGG + Intronic
1184737228 22:46406457-46406479 CAGGAGATGGGTCGGGGCTGTGG - Intronic
1185272495 22:49935611-49935633 GAGGAGCAGGGTGGGGGCGGAGG + Intergenic
1203241708 22_KI270733v1_random:25206-25228 GAGGAGAAGGGTCGGGGCTGAGG - Intergenic
949608265 3:5677569-5677591 CAGGAGGTGCGCTGGGGAGGTGG - Intergenic
950122875 3:10493454-10493476 CAGGAGAGGGGTGGGGAATGAGG + Intronic
950187041 3:10951698-10951720 GGGGAGTAGGGATGGGGAGGAGG - Intergenic
950321403 3:12057992-12058014 ATGGAGAAGGGTTGGGGAATGGG - Intronic
950522554 3:13505516-13505538 CAGAAGAAGGGTGGGGGACGTGG + Exonic
950996144 3:17499220-17499242 TAACAGAAGCGTTGGGGAGGTGG + Intronic
951485182 3:23202919-23202941 CGGGAGAGGGGGTGGGGAGGCGG - Intergenic
952167654 3:30768554-30768576 AGAGAGAAGGGGTGGGGAGGGGG + Intronic
952408214 3:33024608-33024630 CAGCAGAAGGCTAGGGGAGTGGG + Intronic
952515989 3:34105128-34105150 CAGGAGAAGGGGGGGGGTGCTGG + Intergenic
952760144 3:36906235-36906257 AAGGAGATGGGAGGGGGAGGTGG + Intronic
952881431 3:37988315-37988337 CACTGGAAGGTTTGGGGAGGGGG + Intronic
953027120 3:39151774-39151796 CAGAGGGATGGTTGGGGAGGAGG - Intronic
953435084 3:42871627-42871649 AAGGAGAAGAGTTGAGTAGGGGG - Intronic
953801996 3:46031496-46031518 CAGGAGGAAGGCTGAGGAGGGGG + Intergenic
953881196 3:46692348-46692370 TGGGACAGGGGTTGGGGAGGGGG - Intronic
954217591 3:49133125-49133147 AAGGGGTAGGGTTGGGGTGGGGG - Intergenic
954224160 3:49171967-49171989 CAGAAGTGGGGTTGGGGCGGGGG - Intronic
954246925 3:49339666-49339688 CAGGAGGAGGGATGTGGAGAAGG - Intronic
954372321 3:50175305-50175327 CAGGGGAAGGGGTGGGGACAGGG - Intronic
954427349 3:50450340-50450362 CGGGGGCAGGGTAGGGGAGGCGG - Intronic
954491402 3:50910197-50910219 CAGGAGCAGGCTTCAGGAGGTGG - Intronic
955802129 3:62697258-62697280 CAGGGGAAAGGATGGGGAGGGGG - Intronic
956062041 3:65357490-65357512 GGGGAAAAGGGTTGGGGGGGTGG - Intronic
956080215 3:65549351-65549373 CAGGAAGAGGGGAGGGGAGGGGG - Intronic
956444050 3:69308374-69308396 CAGGAGGAGGGTTGAGAGGGAGG - Intronic
956528422 3:70190088-70190110 GAAGAAATGGGTTGGGGAGGGGG - Intergenic
956553362 3:70488075-70488097 GAGGGGAAGGGCTCGGGAGGGGG - Intergenic
956612446 3:71137869-71137891 CAGGAGGAGGGAAGGGGAGAAGG - Intronic
956747432 3:72320789-72320811 AGGGATAGGGGTTGGGGAGGGGG + Intergenic
956794352 3:72704461-72704483 GAGGAGTAGGGTTGTGGTGGGGG + Intergenic
956878647 3:73488866-73488888 CAGCAGCAGAGATGGGGAGGAGG - Intronic
956901178 3:73717517-73717539 CAGGAGTAGGATTGGTGATGTGG - Intergenic
957304465 3:78439773-78439795 CATGAGAAGAGTTGGGCAAGCGG - Intergenic
957703175 3:83745130-83745152 CAGGAGGGAGGTTGGGGAGAGGG - Intergenic
957810367 3:85214534-85214556 CAGGACCAGGGTTGGGGGGTGGG - Intronic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958665376 3:97129736-97129758 GAGCAGCAGGGTTGGGGAGTTGG + Intronic
958906581 3:99948531-99948553 GAGGGGAAGGGAGGGGGAGGGGG + Intronic
958962529 3:100523667-100523689 GAGGAGAAAGGAGGGGGAGGAGG - Intronic
959208280 3:103341829-103341851 GAAGAGACTGGTTGGGGAGGAGG + Intergenic
959950379 3:112174621-112174643 CTGGTGAAGAGTTGGGGTGGTGG + Intronic
960155581 3:114294393-114294415 AAGAAGAAGGGCTGGGCAGGAGG + Intronic
960987973 3:123292702-123292724 CGGGAGAAGGCTGGGGGTGGGGG + Intronic
961082834 3:124041295-124041317 TAAGGGAAGGGTTGGGGCGGGGG - Intergenic
961345454 3:126260682-126260704 AAAGAGAGGGGTAGGGGAGGAGG - Intergenic
961505304 3:127367050-127367072 AGGGGGAAGGTTTGGGGAGGGGG + Intergenic
961745738 3:129062539-129062561 AGGGTGAAGGGTGGGGGAGGTGG - Intergenic
962072257 3:132044786-132044808 GAGGAGAGGGGGAGGGGAGGGGG + Intronic
962443938 3:135448526-135448548 CAGAAGCAGGGTTGGGCAGAGGG + Intergenic
962681083 3:137801072-137801094 GAGGAAGAGGGTTGGGGAAGGGG + Intergenic
962888347 3:139649013-139649035 AAGGAGTAGGGTTGTTGAGGGGG + Intronic
963234708 3:142945521-142945543 CAGTAGGATGGATGGGGAGGTGG + Intergenic
963238985 3:142984223-142984245 CAGGAGAAGGGCTTGAGAGGGGG + Intronic
963327343 3:143877123-143877145 AAGGAGAAGGTGTGGGGAGGGGG - Intergenic
963562676 3:146885887-146885909 GAGGAGAAGGGTAGGAGAAGAGG + Intergenic
963846033 3:150159067-150159089 CAGCAGAAGAATGGGGGAGGTGG - Intergenic
963870496 3:150409598-150409620 TAGGAGGAGGTTTGGGGAGACGG - Exonic
964298740 3:155263313-155263335 CAGGAGATGGGTTAGAAAGGTGG + Intergenic
964332203 3:155615761-155615783 CAGGGGGAGGGTTGGGATGGGGG + Intronic
964564321 3:158033121-158033143 AAAAAGAAGGGTGGGGGAGGAGG + Intergenic
964607393 3:158572513-158572535 TGGGAGGAGGGTTGGGGAGAAGG + Intronic
964717337 3:159736486-159736508 AAGGAGAATAGTTGGGGAGTTGG - Intronic
964755676 3:160089074-160089096 CAGGTGAAGGGAAGGCGAGGAGG - Intergenic
965247459 3:166292027-166292049 CAGGAGATGGAGTGGGAAGGTGG + Intergenic
966631642 3:182082512-182082534 ATGGAGAAGGGTGGGGGAGGGGG - Intergenic
966700197 3:182840989-182841011 GAGAAGAAAGGTTGGGGATGGGG - Intronic
966767745 3:183478296-183478318 CAGGAGGAGGGCTGCGGAAGTGG - Intergenic
967228028 3:187311986-187312008 CAGGGGTGGGGGTGGGGAGGGGG + Intergenic
968132023 3:196197581-196197603 CAGGAGGCGGGTTCAGGAGGCGG + Exonic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968393084 4:208858-208880 CATGATTAGGTTTGGGGAGGAGG + Intergenic
968403333 4:317157-317179 GAGGAGCAGGTCTGGGGAGGAGG + Intergenic
968478211 4:822549-822571 CAGAAACAGGGTCGGGGAGGGGG - Intronic
968517339 4:1020777-1020799 CAGGGGAAGGGGTGGGGCTGGGG + Intronic
968564990 4:1307316-1307338 CAGGGGCTGGGGTGGGGAGGAGG - Intronic
968577383 4:1374239-1374261 CTGCAGCAGGTTTGGGGAGGTGG + Intronic
968618370 4:1592590-1592612 CAGGAGAGGGGCTGGGCAGGGGG - Intergenic
968653806 4:1770230-1770252 AAGGAGGAGGGCTGGTGAGGAGG + Intergenic
968722916 4:2220962-2220984 CAGGAGAAGTTTTTGGGATGGGG - Intronic
968810130 4:2796015-2796037 CAGGCCAAGGGGTGGTGAGGAGG - Intronic
968834012 4:2949620-2949642 GAGGGGCAGGGCTGGGGAGGTGG - Intronic
969063689 4:4460419-4460441 CTAGAGAAGGCTTTGGGAGGGGG - Intronic
969141425 4:5077568-5077590 TGGGAAAAGGGCTGGGGAGGTGG - Intronic
969172143 4:5372709-5372731 CAGGAGAAAGTTGGGGGGGGGGG + Intronic
969192443 4:5533185-5533207 AGGGATATGGGTTGGGGAGGAGG + Intergenic
969214466 4:5711140-5711162 CAGGGGCAGGGCTGGGGCGGGGG + Intergenic
969428204 4:7138140-7138162 TAGGAGAAGAGATGGGGATGAGG - Intergenic
969599457 4:8167336-8167358 CAGGAGAAGGAATGGGGGTGGGG - Intergenic
969600149 4:8171390-8171412 CAGGAGTGGGGCTGGGGAGAGGG - Intergenic
969916749 4:10498971-10498993 AAGGACAAGGGTTGGGGGGGGGG - Intronic
970521932 4:16893512-16893534 CTGGGGAGGGGGTGGGGAGGAGG - Intronic
970829962 4:20325404-20325426 CAGGGGTAGGGTGGGGGTGGGGG + Intronic
971251297 4:24975422-24975444 AAGGAGAAGGAAGGGGGAGGAGG + Intronic
971609761 4:28707939-28707961 CAGGAGAATAGCTTGGGAGGCGG + Intergenic
971813043 4:31452593-31452615 CAGGAGCAGAGGTGGAGAGGTGG - Intergenic
972375769 4:38468817-38468839 AAGGAGAGGCGGTGGGGAGGAGG - Intergenic
972750530 4:41983241-41983263 AAAAAAAAGGGTTGGGGAGGTGG - Exonic
972909426 4:43796838-43796860 CTGCAGAAGGGTGGGGGTGGGGG - Intergenic
972941259 4:44197408-44197430 CAGGAGCAGATCTGGGGAGGGGG + Intronic
973110111 4:46388892-46388914 AAGGAAAAGGGTGGGGGTGGGGG - Intronic
973153888 4:46923938-46923960 CAGGAGAAGAGATGAGGATGTGG - Exonic
973238745 4:47934265-47934287 CAGGAGTGAGGGTGGGGAGGTGG - Intronic
973335803 4:48955389-48955411 GAGGAGAAGGGAAGGGAAGGAGG - Intergenic
973973189 4:56235840-56235862 CAAGACAAGGGTTGGGAAGGAGG + Intronic
974251028 4:59383026-59383048 CAGGAGAAAAGGTGGGAAGGGGG - Intergenic
974833356 4:67216363-67216385 GAAGAGAAGGGGAGGGGAGGGGG + Intergenic
975060100 4:69986208-69986230 CTGGAAAAGGGATGGGGAGTGGG + Intergenic
975465589 4:74705453-74705475 CAGGAGTAGAGTGGAGGAGGGGG + Intergenic
975647796 4:76562675-76562697 CAGGTGAGGGGGTGGAGAGGTGG - Intronic
975920468 4:79380353-79380375 CAGGAGAAGGCTGTGGGGGGTGG - Intergenic
975983548 4:80184073-80184095 CAGGCGAAGGGCGGGGAAGGAGG + Intronic
976022808 4:80650856-80650878 CAGGGGAAAGGATGGGAAGGGGG + Intronic
976443585 4:85104800-85104822 CAGGAGAGGAGTTTGGGATGTGG + Intergenic
976482017 4:85556665-85556687 CGAGTGAAGGGTAGGGGAGGTGG + Intronic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
976753773 4:88477316-88477338 AAGGGGAAGGGAGGGGGAGGGGG + Intronic
976763946 4:88579630-88579652 CAGAAGTAGGGTTGAGGAAGAGG + Intronic
976817107 4:89161655-89161677 AAGAACAAGGGTTGGGGAGTGGG + Intergenic
977323989 4:95551741-95551763 CAGGAGAATGGTTTGAGAAGTGG + Intergenic
977694211 4:99949227-99949249 CCGGAGAAGGTTTGGGGGGCGGG - Intronic
977776357 4:100924563-100924585 CAGGACAGGGATTGGGGAAGAGG + Intergenic
977804600 4:101282022-101282044 CAGGAAAAGGTATGGGGTGGAGG - Intronic
977827811 4:101554286-101554308 CAGACAAAGGGGTGGGGAGGGGG - Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978203125 4:106046578-106046600 GAGGAGATGGGATGGTGAGGAGG + Exonic
978540095 4:109807198-109807220 CAGGAGAAGGGTGGGATATGAGG - Intergenic
978564248 4:110065029-110065051 CATGAGGGAGGTTGGGGAGGGGG + Intronic
978619384 4:110623176-110623198 CCGGAGAAGGGTCTGGGAGGAGG - Intronic
978692364 4:111529488-111529510 CAGGTGAAGGGTTGGACAGTGGG + Intergenic
978764437 4:112389937-112389959 CAGGAGTAGTGATGGGGTGGAGG - Intronic
978828169 4:113049612-113049634 GAGGAGGAGGGGTGGGGAAGGGG - Intronic
980161924 4:129174835-129174857 AAGAAGAAGGGATGGGGTGGGGG + Intergenic
980219854 4:129901019-129901041 CAGGAGAAGGGATGGGAATGGGG - Intergenic
982209082 4:153020493-153020515 CAGGAGGAGAGTGGGGAAGGAGG - Intergenic
983647299 4:170004801-170004823 AAGTAGAGGGGTTGGGGTGGGGG - Intronic
984145301 4:176053147-176053169 AATGAGAAGGGTGGGGGTGGGGG + Intergenic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
984911315 4:184676633-184676655 AAGGAGAAGGGAGGGGGAAGGGG - Intronic
985126688 4:186701675-186701697 CAGGAGAAGGAATGTGGAGGAGG - Intronic
985236416 4:187880290-187880312 GAGGAGAAGGGTTGGGGAGCTGG + Intergenic
985472275 5:53595-53617 GAGGAGAAGGGCGGGGGCGGAGG + Intergenic
985572148 5:652787-652809 CAGGACAGTGGTTGGGAAGGAGG + Intronic
985741789 5:1621780-1621802 CAGCTGAAGACTTGGGGAGGAGG - Intergenic
985891361 5:2717611-2717633 TAGGAGAGGGGATGGGGAGTGGG - Intergenic
985945353 5:3177960-3177982 CAGGAGAAGGGCAGGGGCTGGGG - Intergenic
986278721 5:6304952-6304974 CAGGAGGAGAGATGGTGAGGAGG + Intergenic
986879092 5:12147851-12147873 GAGGAGGAGGGAGGGGGAGGGGG - Intergenic
987037066 5:14029722-14029744 CAGTAGAAGGGTAGAGTAGGAGG - Intergenic
987351513 5:17026238-17026260 AAGGAGAAGGTTTAGGGTGGGGG + Intergenic
987504833 5:18754357-18754379 CAGCAGAATGGATGGGGAGCTGG + Intergenic
988200573 5:28063729-28063751 AAGGAAATGGGTTGGGAAGGGGG - Intergenic
988355320 5:30166400-30166422 CAGGAGAAAGGGTGGGTAGAGGG - Intergenic
988365166 5:30289259-30289281 CAGGAGAAGAGTTGGCAGGGAGG - Intergenic
988445985 5:31286622-31286644 CATGCGAAGGGGTGGGGATGAGG + Intronic
988608781 5:32705548-32705570 GAGGAAGAGGGATGGGGAGGGGG + Intronic
988799865 5:34686321-34686343 CAGGAGCAGGGGTGGGGATGTGG + Intronic
989463216 5:41725220-41725242 CAGGAGAAGGGTGGAGGTGTGGG - Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990440020 5:55834951-55834973 CAGGAGCAGGCTTGGGCAGAGGG + Intergenic
990440246 5:55837167-55837189 CAGGAGAATCGCTTGGGAGGCGG + Intergenic
990506135 5:56447428-56447450 CAGCAGTTGGGTTGGAGAGGAGG - Intergenic
990743715 5:58937261-58937283 CAGGGGAAGGGGAGGGGCGGGGG + Intergenic
990805285 5:59653885-59653907 GAGGAGAAGGGTGGGAGGGGAGG + Intronic
991018344 5:61955247-61955269 GTGGAGAATGGGTGGGGAGGTGG - Intergenic
991347214 5:65682230-65682252 CAGGACAAGGGCTGATGAGGAGG + Intronic
991609564 5:68436310-68436332 CAGGTGAAGGCTTTGGGGGGTGG + Intergenic
991618092 5:68517611-68517633 GAGGAGAAAGGATGGGGTGGGGG + Intergenic
992214057 5:74508217-74508239 AAAGTGATGGGTTGGGGAGGTGG - Intergenic
992215423 5:74520194-74520216 TAGGTGAAGGGTGGGGGTGGGGG + Intergenic
992335519 5:75764529-75764551 CAGGGGAAAGGGTGGGGTGGGGG - Intergenic
992478009 5:77122551-77122573 CATGAGAAGTGATGGTGAGGGGG + Intergenic
992605151 5:78448058-78448080 AAGGAGGAGGGAGGGGGAGGGGG - Intronic
992643037 5:78785902-78785924 CAGAAGAAGGGTCAGAGAGGTGG + Intronic
992740809 5:79771612-79771634 AAGGAGAAGGGATGGGGGGATGG + Intronic
992980257 5:82162829-82162851 CAGGGGCGGGGGTGGGGAGGAGG + Intronic
993456551 5:88133627-88133649 AAAGAGAAGGGTGGGGGTGGGGG + Intergenic
993934912 5:93987232-93987254 AAGGAGTAGGGTGGGAGAGGGGG + Intronic
993986329 5:94602060-94602082 CATGAGAAGGCTGGGCGAGGTGG + Intronic
994121768 5:96121860-96121882 CAAGAGCAGGGGTGGGCAGGGGG - Intergenic
994204939 5:97024040-97024062 CAGATGAAGAGTTGGGGTGGAGG + Intronic
994261156 5:97660290-97660312 CTTGAGAAGGGTTGAGGAGGAGG + Intergenic
994277234 5:97854312-97854334 GAGGAGAAATGTTGGGGGGGTGG + Intergenic
995455428 5:112346934-112346956 CAGGAGAAGGATCTGGGAGTAGG + Intronic
995481317 5:112595908-112595930 CAGGGCAGGGGTTGGGGAGTTGG - Intergenic
995766883 5:115628173-115628195 CAGGGGCAGGGTTGGGGGAGGGG + Intronic
996330296 5:122321020-122321042 CAGGAGAAAATCTGGGGAGGCGG - Intronic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
997180108 5:131819452-131819474 CAGGGGGAGGGAGGGGGAGGGGG + Intronic
997431968 5:133847093-133847115 CAGGAGCAGGGTGGGGCACGAGG + Intergenic
997662909 5:135603280-135603302 CAGGTGCAGGGTTTGGGAGCTGG - Intergenic
997695809 5:135859767-135859789 CAGGAGCAGGGCTGGTGAGTTGG + Intronic
997739842 5:136243892-136243914 GAGGATAAAGGGTGGGGAGGCGG - Intronic
998134283 5:139666523-139666545 CAGGAGAAGGGTCAGGGCTGGGG + Intronic
998136308 5:139676324-139676346 GGGGAGAAGGACTGGGGAGGAGG - Intronic
998136318 5:139676349-139676371 GGGGAGGAGGGCTGGGGAGGAGG - Intronic
998376339 5:141693335-141693357 CAGGAGGAGGCTGTGGGAGGTGG + Intergenic
998522276 5:142812084-142812106 CAGTAGACGGGGTGGGGAGGGGG - Intronic
998854122 5:146378303-146378325 CAGGAGAATTGCTTGGGAGGTGG - Intergenic
999229583 5:150053818-150053840 CATGAGAACAGTAGGGGAGGGGG + Exonic
999238488 5:150114112-150114134 CACGGGGAGGGTTGGGAAGGGGG - Exonic
999259789 5:150230956-150230978 CAGGAGATGAGCTGGGAAGGTGG - Intronic
999610572 5:153364789-153364811 CAGGATGAGGGTTGGGGAACAGG + Intergenic
999690647 5:154143272-154143294 CAGGAGAAGGCTGTGGGATGTGG - Intronic
999762374 5:154712636-154712658 CAGGACCAGGGCTGTGGAGGAGG + Intergenic
999798376 5:155009272-155009294 CATGAGGAGGGCAGGGGAGGTGG - Intergenic
1000185114 5:158851501-158851523 GGGGAGAAGGGAAGGGGAGGGGG + Intronic
1000547275 5:162618928-162618950 GAGGAGTAGGGTTGGGGTGTAGG + Intergenic
1001122525 5:168992121-168992143 CAGGAGAGGGGGTGGGGCAGGGG - Intronic
1001414485 5:171535310-171535332 CAGGAGAAGGATGGGGAATGTGG + Intergenic
1001535261 5:172493617-172493639 CAGAAGAAGGGAAGGGGCGGGGG - Intergenic
1001653235 5:173329721-173329743 CAGGAGGAGGGTGGGGACGGGGG - Intergenic
1001709044 5:173763078-173763100 AAAAAAAAGGGTTGGGGAGGAGG + Intergenic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1001790020 5:174448135-174448157 CAGGAGATGGGAGGAGGAGGTGG - Intergenic
1002085847 5:176774880-176774902 CAGGAGATGGGCTGGAGAAGGGG - Intergenic
1002128694 5:177065803-177065825 CAGGTGAAGGGATAGGGAGTGGG - Exonic
1002450612 5:179316402-179316424 CAGGAGCAGGGCTGGGGAGTCGG + Intronic
1002675699 5:180910782-180910804 CAGGAGGAGGTGTAGGGAGGAGG - Intronic
1002684350 5:180996290-180996312 GAAAAGAAGGGCTGGGGAGGAGG - Intronic
1003010972 6:2427302-2427324 CTGGAGAAGGGAAGGGAAGGGGG + Intergenic
1003187863 6:3848976-3848998 GAGGAGGAGGGTTGGAGAGCAGG + Intergenic
1003361356 6:5429079-5429101 CAGGAGAAGAGTGGGGCAGTGGG + Intronic
1004075435 6:12340256-12340278 GAGGAGAAGAGTTGGGATGGGGG + Intergenic
1004326376 6:14677430-14677452 GGGCGGAAGGGTTGGGGAGGTGG - Intergenic
1005083435 6:21980486-21980508 CAGGAGCAGGGAGGAGGAGGTGG - Intergenic
1005450038 6:25963366-25963388 CAGGAGTAGGGGTGTGGGGGCGG + Intronic
1005989890 6:30896229-30896251 CGGGACAAGGGTTTGGAAGGTGG + Intronic
1006002017 6:30972582-30972604 CAGGAGAGGGGTGGTGGGGGAGG - Intergenic
1006511902 6:34526034-34526056 AAGGAGGAGGGATGGGGAGTTGG + Intronic
1006767580 6:36522334-36522356 CAGGAGCAGGGTGGCAGAGGGGG + Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006860658 6:37170013-37170035 GAGGAGAGGGGGTGGGGAAGCGG - Intergenic
1006900107 6:37494464-37494486 AAGGAGCAGGGGTGGGGAGTCGG - Intronic
1007090248 6:39179819-39179841 CAGGAGTAGGGGTGGGGGTGTGG + Intergenic
1007301474 6:40871074-40871096 CAGCAGCAGGGATGAGGAGGAGG + Intergenic
1007590181 6:43016340-43016362 CAGTAGCAGGGATGGGGAAGTGG + Intronic
1007693384 6:43716982-43717004 ATGGAGGAGGGTTGGGGTGGGGG + Intergenic
1008930358 6:56932509-56932531 CAAGAGAAGGGTGGGAGAGAAGG + Intronic
1009008303 6:57813574-57813596 CAGGAAAATGGGTGGGGTGGCGG - Intergenic
1009595424 6:65729276-65729298 CAGACGAAGGGGTGGGAAGGAGG - Intergenic
1011155810 6:84329796-84329818 AGGGAGCAGGGATGGGGAGGGGG + Intergenic
1011218283 6:85028792-85028814 GAGGAGAAGGGTAGGGGAGCAGG - Intergenic
1012290284 6:97447163-97447185 CAGGAGAAGGATGAGGGAGTAGG - Intergenic
1013056593 6:106589192-106589214 GAGGAGGAGGGAGGGGGAGGAGG + Intronic
1013376355 6:109518952-109518974 AAGGAGGAGGGTTGGGGAGAGGG - Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1013584461 6:111566099-111566121 CAGGAGACGGGGTGGTGAGGAGG - Intronic
1013763002 6:113540067-113540089 CAGGAGCTGGTGTGGGGAGGTGG - Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014484083 6:121977761-121977783 CAGGAGAAGGGAGTGGGTGGTGG + Intergenic
1015098010 6:129440436-129440458 CAGGGCAGGGGTTGGGGTGGGGG - Intronic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1016045851 6:139479647-139479669 ATGGAGGAGGGGTGGGGAGGGGG + Intergenic
1016590563 6:145739124-145739146 AAGGAGAAGTGAAGGGGAGGAGG - Intergenic
1016871896 6:148825937-148825959 CAGGAATAGGGTTGAGGAGGGGG + Intronic
1017010131 6:150057894-150057916 CAGGCGACGGGGTGGGGAAGGGG - Intergenic
1017205436 6:151800209-151800231 CAGGAGAAGGTATGCAGAGGAGG + Intronic
1017206570 6:151808931-151808953 CAGGACGTGGGGTGGGGAGGAGG - Intronic
1017277630 6:152588603-152588625 GATAGGAAGGGTTGGGGAGGAGG + Intronic
1017637419 6:156456306-156456328 GAGGGGAGGGGATGGGGAGGAGG - Intergenic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018274730 6:162118310-162118332 CAGGAGAATGGTTGTGAAGCCGG + Intronic
1018298461 6:162375351-162375373 CTGGAGTAGGGGTGGGGAGCGGG + Intronic
1018854356 6:167664785-167664807 CAGGAGCAGAGCTGGGGAGCAGG + Intergenic
1018854464 6:167665799-167665821 CAGGAGCAGAGCTGGGGAGAAGG - Intergenic
1019283242 7:211102-211124 AGGGAGAAGGCTGGGGGAGGCGG - Intronic
1019313449 7:373927-373949 GAGGAGAAGGGAAGGGAAGGAGG + Intergenic
1019487151 7:1294536-1294558 GATGGGAAGGGTTGGGGACGGGG + Intergenic
1019550351 7:1599284-1599306 CAGGAGAAAGGGTGGGGGGTGGG + Intergenic
1020032860 7:4945070-4945092 CAGAAGAAGGGGTCGGGGGGAGG - Intronic
1020080179 7:5282677-5282699 GAGGAGGAGGAATGGGGAGGAGG + Intronic
1020111167 7:5448574-5448596 CAGGAGCAGGGGTTGGGAAGGGG + Intronic
1020429580 7:8105257-8105279 TAGGAGCAGGGTGGGGGATGGGG + Intergenic
1020441906 7:8226232-8226254 GTGGGGAAGGGTTGGAGAGGAGG - Intronic
1020466500 7:8485589-8485611 CAGGAGATAGGTAGGGGTGGAGG + Intronic
1020974407 7:14987610-14987632 CAGGAAAGGAGTTGGGGAAGCGG + Intergenic
1021413960 7:20360494-20360516 CAGAAGAAGGGTTTGGGAGAGGG - Intronic
1021476508 7:21067340-21067362 CACGAGAATGGTTGATGAGGTGG - Intergenic
1021934448 7:25615881-25615903 GAAGAGCAGGGTTGTGGAGGAGG + Intergenic
1022261645 7:28711191-28711213 CAGGAGAGGGGCTAGGGAAGAGG + Intronic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023010008 7:35917913-35917935 CAGGATGAGGGGTGAGGAGGAGG - Intergenic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023392111 7:39720635-39720657 CATGAGAAGGGCAGGAGAGGAGG - Intergenic
1023522087 7:41059151-41059173 CAGCAGGAGAGTAGGGGAGGGGG - Intergenic
1023697945 7:42866451-42866473 CAGGAGATGGGATGGGCTGGAGG - Intergenic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1023822750 7:43988930-43988952 CTGGGGAAGGGTGGGGGACGAGG + Intergenic
1023832561 7:44048371-44048393 CAAGAGAAAGATTTGGGAGGTGG - Intronic
1023839055 7:44085720-44085742 CTGGAGGATGGTTGGGGAGGGGG + Intergenic
1023883688 7:44335716-44335738 AGGGGGAAGTGTTGGGGAGGGGG - Intergenic
1024080823 7:45853666-45853688 CAGGATGAGGGGTGAGGAGGAGG + Intergenic
1024089181 7:45921344-45921366 CAGGAGTGGGGGTTGGGAGGGGG + Intronic
1024139629 7:46448704-46448726 TGGGAGTAGGGTTGGGGAGAAGG + Intergenic
1024825803 7:53388009-53388031 AAGGAGAAGGGTGAGGGAAGAGG - Intergenic
1024912796 7:54465258-54465280 CAGGAGCAGGGATAAGGAGGTGG - Intergenic
1024920139 7:54546266-54546288 CAGGAGAGAGGGTGGTGAGGTGG + Intronic
1025790219 7:64681502-64681524 ATGGTGAAGGGTTGGGGAGAAGG - Intronic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025936194 7:66039599-66039621 CAGGATGAGGGATGGAGAGGGGG + Intergenic
1025941077 7:66076460-66076482 CAGGAGAAGGGATGTGGTGTGGG - Intronic
1025945366 7:66100324-66100346 AAGGAGGAGGGGAGGGGAGGGGG + Intronic
1026162662 7:67883309-67883331 AAGGAGAAGGGAAGGGAAGGAGG - Intergenic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1026631012 7:72038264-72038286 CAGGAGAAGCTTTGGGGGTGGGG - Intronic
1026641132 7:72126604-72126626 CAGGAGAAAGGTAGGGGAAAGGG - Intronic
1026769621 7:73187155-73187177 GAGGAGCAAGGTGGGGGAGGAGG + Intergenic
1026816983 7:73521470-73521492 GAGGAGGAGGCGTGGGGAGGGGG - Intronic
1027010490 7:74740541-74740563 GAGGAGCAAGGTGGGGGAGGAGG + Intronic
1027057725 7:75061559-75061581 GAGGAGAAGGGTTATGGAGAAGG - Intronic
1027077552 7:75205503-75205525 GAGGAGCAAGGTGGGGGAGGAGG - Intergenic
1027138211 7:75639232-75639254 CCGGAGAAAGGAAGGGGAGGGGG + Intronic
1027203662 7:76080131-76080153 GAGGAGAGAAGTTGGGGAGGAGG - Intergenic
1027230893 7:76271759-76271781 CAGAAGGAGGATTTGGGAGGTGG + Intronic
1027263150 7:76479234-76479256 AAGGAGAAGGTCTCGGGAGGTGG + Intronic
1027314534 7:76977339-76977361 AAGGAGAAGGTCTCGGGAGGTGG + Intergenic
1027354323 7:77341325-77341347 GAGGAGCAGCCTTGGGGAGGAGG - Intronic
1027775994 7:82465076-82465098 GAGGAGAATGGATGGGGATGGGG + Intergenic
1027954931 7:84865640-84865662 CAGGAAAAGGGTTGGGGACCGGG + Intergenic
1028179370 7:87699857-87699879 GATGAGAATGGTTGGGTAGGTGG + Intronic
1028628399 7:92904483-92904505 CAGAAGAGGGGTGGGGAAGGAGG - Intergenic
1028710558 7:93903045-93903067 CAGGAGGAGGGTGGGAGTGGGGG - Intronic
1029117168 7:98243341-98243363 CAGGAGCAGGCATGGGGTGGGGG + Intronic
1029392147 7:100282526-100282548 GAGGAGAAGGGGAGGGGAAGGGG - Intergenic
1029460547 7:100691747-100691769 AAAGAGAAGGGGTGGGGAAGGGG - Intergenic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029751015 7:102542345-102542367 CTGGGGAAGGGTGGGGGACGAGG + Intronic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1029768968 7:102641456-102641478 CTGGGGAAGGGTGGGGGACGAGG + Intronic
1030638258 7:111974575-111974597 AAGGAAAAGGGATGGGGAGGAGG + Intronic
1030820382 7:114085816-114085838 GGGGAGAAGGGTGGGGGTGGGGG + Intergenic
1030971409 7:116062018-116062040 TAGGGGAAGGGATGGGAAGGAGG - Intronic
1031001944 7:116425741-116425763 CTGGGGAAGGGGTGGGGAGTGGG - Intronic
1031011435 7:116528076-116528098 CATGAGAAGGGTGGGGGTGGGGG - Intronic
1031185297 7:118472294-118472316 TAGGAGACGGGGTGGTGAGGAGG - Intergenic
1031300093 7:120054246-120054268 CAGGAGAAGGGGCTGGGATGAGG + Intergenic
1031586360 7:123535180-123535202 GAGGCGAAGGGGCGGGGAGGAGG + Intergenic
1031866164 7:127040065-127040087 GGGGAGATGGGTGGGGGAGGAGG + Intronic
1031866182 7:127040106-127040128 GGGGAGATGGGTGGGGGAGGAGG + Intronic
1031921053 7:127600840-127600862 CAGGAGAAGGGTTGGGGCTGAGG - Intronic
1032189322 7:129754544-129754566 CTGGGGAAGGGTTGGGGAGGGGG + Intronic
1032398874 7:131610111-131610133 CAGGACAGGGGTTGGGGTGGAGG - Intergenic
1032515997 7:132506742-132506764 CAGGAGAAGGGTTGGCTTAGGGG - Intronic
1032579988 7:133095460-133095482 CAGGAGAAAGGAGGGGAAGGTGG + Intergenic
1032648748 7:133854773-133854795 AAGGAAAAGGGATGGTGAGGAGG - Intronic
1032704567 7:134410770-134410792 CAGGAGAAGTGGCGGGGCGGCGG - Intergenic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1033590202 7:142802434-142802456 CAGGAGTAGGGCAGGGGAGGCGG - Intergenic
1033594533 7:142847789-142847811 CAGGAGAAGGGAAGGGGAGTTGG + Intergenic
1033628973 7:143138968-143138990 GAGGAGAAGAGTGGGGGTGGAGG - Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1033767097 7:144505855-144505877 CAGCAGAATGGATGGGGAGCTGG - Intronic
1033832638 7:145271804-145271826 GAGGAGAAGAGGAGGGGAGGAGG + Intergenic
1033862294 7:145643600-145643622 CAGGTGAAGGGTTGGACAGTGGG + Intergenic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034062506 7:148106017-148106039 CAGCAGAAGGAATGGAGAGGAGG + Intronic
1034268343 7:149791704-149791726 CAGGTGAGGGGCTGGGGTGGTGG + Intergenic
1034391853 7:150793394-150793416 CTGGACAAGGGCTGGGGAAGAGG - Intronic
1034437427 7:151069872-151069894 CAGGAGATGGGATGGGGAGCAGG - Intronic
1034442291 7:151091999-151092021 TAGGAGATGGGTGGGTGAGGTGG + Intronic
1034494692 7:151412358-151412380 CAAGTGAAGGGTTGGGGGGCGGG + Intergenic
1034530939 7:151696169-151696191 AAGGAGAAGGGAGGAGGAGGAGG - Intronic
1034735822 7:153428636-153428658 AAAGAGAAGGGTTGGGTGGGGGG + Intergenic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035307635 7:157943495-157943517 CAGGAGCAGGGATGGGGCGGAGG - Intronic
1035372838 7:158390498-158390520 CTGGAGAAGGGATGGGGTCGGGG - Intronic
1035637292 8:1156344-1156366 CCGGAGGAGAGTTGGGGAGGCGG + Intergenic
1036441519 8:8785852-8785874 CTGGGGAAGAGGTGGGGAGGGGG - Exonic
1036631545 8:10519302-10519324 AATGAGAAGAGATGGGGAGGAGG - Intergenic
1036807713 8:11846930-11846952 CAGGTGAGGGGCTGGGGAAGAGG - Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037599466 8:20381758-20381780 CTGGAGAACGGGTTGGGAGGCGG - Intergenic
1037631530 8:20661062-20661084 CAGCAGAAGAGTTGGTGAGAAGG - Intergenic
1037691206 8:21183178-21183200 GAGGAGAAGTGTAGGGGAGGAGG - Intergenic
1037737790 8:21581152-21581174 CAGGGGAAGGGTTGAGGACATGG - Intergenic
1037743186 8:21623292-21623314 GAGGAAAAGTGTTGGGGAGAGGG + Intergenic
1037803645 8:22048280-22048302 AAGGGAAAGGGGTGGGGAGGCGG - Exonic
1037804250 8:22050322-22050344 AAGGAGGTGTGTTGGGGAGGGGG + Intronic
1037916384 8:22775773-22775795 CGAGAGAGAGGTTGGGGAGGCGG + Intronic
1037928599 8:22864558-22864580 CAGGAGAAAGCTTGGGGGAGGGG + Intronic
1037976657 8:23218771-23218793 CAGTAGAGGGGCTGGGCAGGAGG - Intronic
1038042631 8:23737979-23738001 AAGGGGAAGGGGTGGGGAGGAGG - Intergenic
1038424879 8:27458644-27458666 CAGGGGTAGGGGTGGGGAGAGGG - Exonic
1038699357 8:29835526-29835548 CAGGGGATGGTGTGGGGAGGAGG - Intergenic
1038925936 8:32139368-32139390 AAGGAGAAGGGATGGCTAGGCGG - Intronic
1039000738 8:32977230-32977252 CGGGAGAAAGGGTGGGAAGGAGG - Intergenic
1039030559 8:33304569-33304591 CAGGAGAAAGGGTGGGAGGGGGG + Intergenic
1040960734 8:53029736-53029758 CCGGAGAAAAGTTGGGAAGGGGG - Intergenic
1042212235 8:66392331-66392353 TAGGAGAAGGGAGGGGAAGGAGG - Intergenic
1043010957 8:74880858-74880880 GAGCAGAAGGGTTTAGGAGGGGG - Intergenic
1043314929 8:78908734-78908756 GAGGAAAAGGGAGGGGGAGGAGG + Intergenic
1043561538 8:81499557-81499579 CAGCAGATGAGTTGGGGGGGGGG + Intergenic
1043812122 8:84753658-84753680 TAGGAGAAAGGGTGGGGAAGAGG - Intronic
1044697498 8:94937533-94937555 AGGAAGAAGGGATGGGGAGGAGG + Intronic
1044728558 8:95212544-95212566 CAGGTGAGGGGTGGGGGATGAGG + Intergenic
1044741045 8:95326684-95326706 CACAAATAGGGTTGGGGAGGGGG + Intergenic
1044983239 8:97736368-97736390 GAGGAGAAGGGAGGGGGAGGAGG + Intergenic
1046612444 8:116440974-116440996 CAGCAGAAGGCATGGGGTGGGGG - Intergenic
1046936442 8:119889583-119889605 GGAGAGAAGGGGTGGGGAGGTGG + Intronic
1047105237 8:121724477-121724499 AAGGGGAAGGGTTCGGGTGGGGG + Intergenic
1047205488 8:122799948-122799970 CAGGAGAATCGTTTGGGAGGTGG - Intronic
1047217469 8:122888060-122888082 CTGGAGAAGGGGTAGAGAGGGGG - Intronic
1047274443 8:123395300-123395322 CAGCAGCTGGGGTGGGGAGGTGG + Intronic
1047294570 8:123559518-123559540 CAGGAGACAGGGTGGGGATGGGG + Intergenic
1047615190 8:126557676-126557698 CAGGCGAAGGGCTGGGGACAGGG - Intronic
1047684083 8:127286251-127286273 CATGAAAAGTGTTGGTGAGGAGG - Intergenic
1047757017 8:127926639-127926661 CAGGAGAAAGGAAGGGAAGGTGG - Intergenic
1047962166 8:130018284-130018306 CAGGAAAAGGGTTTGGAAGCAGG + Intergenic
1048773189 8:137917828-137917850 CATGGGAAGGGTTGGTGAAGAGG - Intergenic
1048934445 8:139343453-139343475 CTGCAGCAGGGTTGGGGAGAGGG + Intergenic
1048934500 8:139343794-139343816 AGGGAGGAGGGTTGGGGTGGGGG + Intergenic
1049030409 8:140032404-140032426 CTGGAGGAGGGTGGGGGGGGAGG - Intronic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049194868 8:141309176-141309198 CAAGACAAGGTCTGGGGAGGCGG + Intergenic
1049361119 8:142212997-142213019 GAGGAGGAGGGAGGGGGAGGAGG - Intronic
1049402061 8:142432809-142432831 TGGGAGGAGGGCTGGGGAGGGGG - Intergenic
1049586582 8:143435259-143435281 CAGGAGCAGGGTGGGGGTGGAGG - Intergenic
1049745796 8:144262804-144262826 CAGGTGAGGGGTGGGGGGGGGGG - Intronic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1050151513 9:2622626-2622648 CAGGCGCAGTGTTGGGAAGGAGG + Intronic
1050329373 9:4530132-4530154 AAGGAGGAGGTTTGTGGAGGGGG + Intronic
1050663638 9:7911066-7911088 GAGGACAGGGGTTGGGGTGGAGG - Intergenic
1052991927 9:34523387-34523409 CGGGAGAGGGGATGGGGTGGGGG + Intergenic
1053263859 9:36696072-36696094 CAGGAGAAGGGGTGAGGAGAAGG - Intergenic
1053272943 9:36762691-36762713 CAGGAGACGGGCTAGGGAGAGGG - Intergenic
1053300910 9:36948816-36948838 CAGGAAAGGAGTTGGAGAGGAGG - Intronic
1053303018 9:36965053-36965075 AAGGAGAAGGGGTGTGGGGGTGG - Intronic
1053434777 9:38067759-38067781 CAGGAAAAGGGCGCGGGAGGAGG + Intronic
1053763679 9:41366989-41367011 GAGGAGAAGGGGAGGGGAAGGGG - Intergenic
1054793882 9:69280616-69280638 CAGGAGAAGGAAGGGGGAAGGGG + Intergenic
1054812680 9:69447286-69447308 GTCTAGAAGGGTTGGGGAGGAGG - Intronic
1054835457 9:69671810-69671832 CAGCAGAGGGGATGGGGTGGCGG - Intronic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1055108223 9:72534381-72534403 CAGAAAAAGTGGTGGGGAGGTGG + Intronic
1055480283 9:76702918-76702940 AAGGAGTAGGGTTGAGTAGGGGG - Intronic
1055522686 9:77097588-77097610 CAGGGGAGGGGGTGGGGTGGGGG - Intergenic
1055980013 9:81992112-81992134 AAGGACAGAGGTTGGGGAGGGGG - Exonic
1056381687 9:86062387-86062409 GAGGAGAGAGGATGGGGAGGAGG + Intronic
1056520690 9:87398653-87398675 CAGGAGAAGTTTAGGAGAGGAGG + Intergenic
1056728940 9:89147390-89147412 CAGGAGGATGGGTGGGGAGTTGG - Intronic
1056824532 9:89867606-89867628 GAGAAGAAGGGATGGGGAAGGGG - Intergenic
1057314323 9:93958897-93958919 TAGGAGAAGGGTGTGGGTGGAGG - Intergenic
1057409377 9:94803745-94803767 AAGGACCAGGGTAGGGGAGGGGG - Intronic
1057489355 9:95509243-95509265 GAGGAGGAGGGGAGGGGAGGGGG + Intronic
1057532001 9:95857176-95857198 CAGCAGAAGTGATGGGGGGGAGG + Intergenic
1057548609 9:96035822-96035844 TAGGAGATGGGTTGAGGAGGTGG + Intergenic
1057721273 9:97534015-97534037 GAGAAAAAGGGATGGGGAGGGGG + Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1057860532 9:98637301-98637323 CAAGAAAGGGCTTGGGGAGGGGG - Intronic
1058133939 9:101286525-101286547 CAGGCAAGGGGTTGGGGTGGGGG + Intronic
1058503878 9:105649504-105649526 CAAGAGAAGAGGTGGGGTGGGGG - Intergenic
1058841291 9:108912063-108912085 CAGGAAACTGGTGGGGGAGGGGG + Intronic
1059310628 9:113386818-113386840 CAGAAGCAGGGTCGGGGTGGAGG - Exonic
1059331556 9:113538787-113538809 CAGGAGAAGGATGAAGGAGGGGG + Intronic
1059409681 9:114124247-114124269 CAGGGGTAGGGTGGGGGTGGGGG - Intergenic
1059651889 9:116322869-116322891 TAGGAAAAGGAATGGGGAGGAGG - Intronic
1059693330 9:116707507-116707529 GTGGGGAGGGGTTGGGGAGGAGG - Intronic
1060007547 9:120013936-120013958 CACGGGAAGGCTTGGGGAAGGGG + Intergenic
1060018061 9:120104424-120104446 GAGGAGAAGGATTGGGATGGTGG + Intergenic
1060210050 9:121704669-121704691 AAGAAGAAGGGAGGGGGAGGAGG - Intronic
1060316015 9:122511268-122511290 CAGGAGAAGGGTGTGAGAGAGGG - Exonic
1060332465 9:122685835-122685857 AAGGAGAGCGGATGGGGAGGAGG - Intergenic
1060374830 9:123108550-123108572 CAGGAGACAGGTTGTTGAGGTGG - Intergenic
1060767770 9:126307864-126307886 AAGCAGAAGGGTCTGGGAGGGGG + Intergenic
1060937083 9:127522062-127522084 CAGGCCAGGGGCTGGGGAGGCGG + Intronic
1060962462 9:127690662-127690684 CCAGACCAGGGTTGGGGAGGGGG + Intronic
1061053389 9:128209023-128209045 GACTAGGAGGGTTGGGGAGGCGG + Intronic
1061085071 9:128393660-128393682 CAGGAGAAGGGAGGGGGCGATGG - Intergenic
1061180465 9:129022437-129022459 AAGGCCAAGGGGTGGGGAGGGGG + Intronic
1061181939 9:129029516-129029538 TTGGAGGAGGGTTGGGGTGGCGG + Intergenic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061661165 9:132131287-132131309 CAGGAGAAGGGATGGGGAGCAGG + Intergenic
1061741973 9:132713737-132713759 CAGGAGACTGGGTGGGGAGAAGG + Intergenic
1061942487 9:133891252-133891274 CAGCAGGAGGGATGGGGGGGAGG + Intronic
1062067914 9:134538759-134538781 CAGCAACAGGGTCGGGGAGGGGG - Intergenic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062447100 9:136599653-136599675 CAGGAGCAGAGTTGGGGTGGGGG - Intergenic
1062502916 9:136858905-136858927 CAGGAGCAGAGGTGGGGAGGTGG + Intronic
1062513730 9:136921769-136921791 CTGGAGAGGGGGTGGGGTGGTGG + Intronic
1062612220 9:137380393-137380415 CTGGAGGGGGGTTGGGGAGGAGG - Intronic
1062612339 9:137380646-137380668 CCAGAGGGGGGTTGGGGAGGAGG - Intronic
1203458031 Un_GL000220v1:8281-8303 GAGGAGAAGGGTCGGGGCTGAGG - Intergenic
1185459872 X:328953-328975 GAGGAGAGGGGAGGGGGAGGGGG - Intergenic
1185581547 X:1213682-1213704 CAAGAGAAAGGAAGGGGAGGTGG - Intergenic
1185589102 X:1262082-1262104 GAGGAGGTGGGTTGGGGAGGAGG - Intergenic
1185608495 X:1380566-1380588 GAGGGGGAGGGTGGGGGAGGGGG + Intronic
1185772219 X:2773405-2773427 GAGGAGAAAGGTTGGAGGGGAGG + Intronic
1186156587 X:6732593-6732615 AAGGAGAAGGGAAGGGAAGGAGG + Intergenic
1186388369 X:9133007-9133029 CAGGAGCAAGGTAGGGGAGAAGG + Intronic
1188336790 X:28945593-28945615 CAGTTGGAGGGTTGGGGATGAGG + Intronic
1188371787 X:29378793-29378815 CAGGAGCAGGCCTGGTGAGGAGG - Intronic
1188441089 X:30215794-30215816 CAGGGGAAGGGTGGGGGGAGGGG + Intronic
1188673661 X:32912082-32912104 GAGGAGAAGGAATGGGGAGGAGG + Intronic
1188695851 X:33189682-33189704 GAGGAGAAGGGTAGGAGAGGAGG + Intronic
1189116065 X:38343879-38343901 CAGGAAAAGGGATGGAGAGGGGG + Intronic
1189198173 X:39168970-39168992 CAGGAGAGGGGCAGGGGACGGGG + Intergenic
1189434168 X:40976536-40976558 CAGAGGAAAGGGTGGGGAGGGGG - Intergenic
1189717560 X:43881930-43881952 AGGGAAAAGGGGTGGGGAGGTGG - Intronic
1189739173 X:44100913-44100935 GAGGAGATGAGTTGGGGAGTAGG + Intergenic
1189782747 X:44531696-44531718 CAGGAAAAAGGTTGGGGAGGGGG + Intronic
1190117549 X:47636219-47636241 TGAGAGAAAGGTTGGGGAGGTGG + Exonic
1190569379 X:51766184-51766206 CAGCAGAAAGGCTGGGGAGCTGG - Intergenic
1190739860 X:53281587-53281609 CTAGGGAAGGGCTGGGGAGGAGG - Intronic
1191090606 X:56616630-56616652 GTGGAGAAGGGATGGGAAGGTGG + Intergenic
1191714606 X:64185659-64185681 CTGGAGCAGGGCAGGGGAGGGGG + Exonic
1191871712 X:65751826-65751848 CAGGAGAAGGAATGGGAATGGGG - Intergenic
1192231882 X:69271019-69271041 CGGGGGAAAGGGTGGGGAGGAGG - Intergenic
1192274360 X:69615122-69615144 CAGGAGAAGGATGGGAGGGGTGG + Intergenic
1193062497 X:77221102-77221124 CAGAAGAAGGCTTCAGGAGGTGG + Intergenic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193321196 X:80123434-80123456 CAGGAGAAGGTGAGGGGCGGAGG - Intergenic
1194318488 X:92412016-92412038 GAGGAGGAGGGGTGAGGAGGAGG + Intronic
1194622133 X:96186515-96186537 GAGGAGAAGGGTTGTTAAGGGGG - Intergenic
1194799158 X:98250500-98250522 CAGGGGGAGGGTTGGAGAGATGG - Intergenic
1195678453 X:107525281-107525303 AAGGAGAAGGGCAGGGCAGGTGG - Intronic
1195884786 X:109626479-109626501 CTGAAGAACGGTTGGGGAAGAGG - Intronic
1195958138 X:110356078-110356100 GAGGAGGAGGGTTGGGGAAAGGG + Intronic
1196107753 X:111914517-111914539 TAGGAGAAAGGTGGAGGAGGAGG + Intronic
1196831743 X:119781268-119781290 CAGGACAAGGGAATGGGAGGTGG + Intergenic
1197728529 X:129792302-129792324 CAGGAGATGGGGCAGGGAGGAGG - Intronic
1197761105 X:130028919-130028941 CAGGAGGGGGGTGGGGGATGGGG + Intronic
1197795221 X:130291098-130291120 CGGGAGATGGGGTGGGGATGGGG - Intergenic
1197894913 X:131302373-131302395 AAAAAGAAGGGTTGAGGAGGGGG - Intronic
1198024002 X:132687248-132687270 CAGCAGAAGGGGAAGGGAGGAGG + Intronic
1198256586 X:134929422-134929444 CAGGAGAAGAGTTTGGGATCTGG + Intergenic
1199142570 X:144331084-144331106 CAGAAGGAGTGTTGGGGATGTGG + Intergenic
1199717776 X:150518516-150518538 CAGGAGAGGGGATGGGGAGGTGG + Intergenic
1199834262 X:151573077-151573099 CAGGGGAAGTTTTGGGGTGGGGG + Intronic
1199846729 X:151697060-151697082 AAGGAGAAGGGAAGGGAAGGAGG - Intronic
1199894605 X:152118086-152118108 CAGGATAGGGGTGGGGGATGTGG + Intergenic
1199924852 X:152451403-152451425 GGGGAGAAGGGGAGGGGAGGAGG - Intergenic
1199936561 X:152580146-152580168 AGGGAGCAGGGTGGGGGAGGGGG - Intergenic
1199996957 X:153031567-153031589 CAGCAGATGGGCTTGGGAGGGGG + Intergenic
1200038265 X:153347058-153347080 GAGGAGAAGGGCTGGGAATGTGG + Exonic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200766329 Y:7083685-7083707 CAGCAGACCGGTTGGAGAGGAGG - Intronic
1201283396 Y:12359930-12359952 CAGGGCAAGGGATGGGGATGAGG + Intergenic
1201739701 Y:17310933-17310955 GAGGAGAAGGGGGGAGGAGGAGG - Intergenic
1202274377 Y:23100263-23100285 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1202291650 Y:23320408-23320430 GAGGAGGAGGGAGGGGGAGGAGG + Intergenic
1202384851 Y:24315867-24315889 GAGGAGTAGGGGAGGGGAGGAGG + Intergenic
1202427370 Y:24734014-24734036 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1202443421 Y:24936080-24936102 GAGGAGGAGGGAGGGGGAGGAGG + Intergenic