ID: 1061408061

View in Genome Browser
Species Human (GRCh38)
Location 9:130403497-130403519
Sequence CATGGTGACAGGAGAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 8, 3: 33, 4: 392}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061408061_1061408081 30 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408081 9:130403550-130403572 TGAGGTGGGAGGTCGGGAGGGGG No data
1061408061_1061408069 6 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408069 9:130403526-130403548 GATGCCATCCGAGCACTCGGTGG No data
1061408061_1061408079 28 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408079 9:130403548-130403570 GCTGAGGTGGGAGGTCGGGAGGG No data
1061408061_1061408080 29 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408080 9:130403549-130403571 CTGAGGTGGGAGGTCGGGAGGGG No data
1061408061_1061408076 23 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408076 9:130403543-130403565 CGGTGGCTGAGGTGGGAGGTCGG No data
1061408061_1061408078 27 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408078 9:130403547-130403569 GGCTGAGGTGGGAGGTCGGGAGG No data
1061408061_1061408071 12 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408071 9:130403532-130403554 ATCCGAGCACTCGGTGGCTGAGG No data
1061408061_1061408068 3 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408068 9:130403523-130403545 TGAGATGCCATCCGAGCACTCGG No data
1061408061_1061408074 16 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408074 9:130403536-130403558 GAGCACTCGGTGGCTGAGGTGGG No data
1061408061_1061408073 15 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408073 9:130403535-130403557 CGAGCACTCGGTGGCTGAGGTGG No data
1061408061_1061408075 19 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408075 9:130403539-130403561 CACTCGGTGGCTGAGGTGGGAGG No data
1061408061_1061408077 24 Left 1061408061 9:130403497-130403519 CCAACCCTTCTCCTGTCACCATG 0: 1
1: 0
2: 8
3: 33
4: 392
Right 1061408077 9:130403544-130403566 GGTGGCTGAGGTGGGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061408061 Original CRISPR CATGGTGACAGGAGAAGGGT TGG (reversed) Intronic
900989468 1:6091637-6091659 GATGGTGCCATGGGAAGGGTTGG + Intronic
901064380 1:6487947-6487969 CATGGGGACAGGAAAGGGCTCGG + Intronic
901771597 1:11533164-11533186 CATGGAGAAAGTAGAATGGTGGG - Intronic
903260305 1:22128269-22128291 ACAGGTGTCAGGAGAAGGGTTGG + Intronic
903814069 1:26051783-26051805 CTTGGTGACAGGCCCAGGGTGGG - Exonic
904375573 1:30080202-30080224 CAAGGCTACAGGAGAAGGGAAGG - Intergenic
905889666 1:41511185-41511207 CATGGAGGGCGGAGAAGGGTCGG + Exonic
906509593 1:46403412-46403434 GATGGAGACAGGAGAGGGCTGGG - Intronic
907303765 1:53502910-53502932 CAGGGAGACAGGAGAGGGGAGGG + Intergenic
907805840 1:57819037-57819059 CATGGGGATAGAAGAAGGGAGGG - Intronic
908163480 1:61434930-61434952 AATGATGTCAGGAAAAGGGTTGG + Intronic
908572884 1:65427431-65427453 CATGGTGCCTGTAGCAGGGTTGG + Intronic
910414173 1:86981043-86981065 CATGGTGGAAGGCGAAGGGGAGG + Intronic
911653015 1:100411086-100411108 GATGGGGAGTGGAGAAGGGTGGG - Intronic
911775523 1:101806558-101806580 CATGGGGACAGGGGAAGGGAAGG - Intronic
911792215 1:102031833-102031855 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
912883861 1:113448405-113448427 TAATGTGAAAGGAGAAGGGTAGG - Intronic
913341206 1:117759518-117759540 CATGTCGACAGGAGAGGGGAGGG + Intergenic
914676102 1:149908594-149908616 CAGGGTGATGAGAGAAGGGTGGG - Intronic
914876470 1:151516158-151516180 CAGGGTGAGATGAGAAGGGAGGG - Intronic
914893153 1:151645926-151645948 AGTGGTTACAGCAGAAGGGTTGG + Intronic
915392826 1:155560055-155560077 CATGTTGACAGGAGAACTTTAGG - Intronic
915904293 1:159866520-159866542 CATGGTTGCATGAGAAGGGCAGG + Intronic
915920863 1:159974206-159974228 CATGCTGACCAGAGAAGGGCAGG + Intergenic
916289618 1:163150529-163150551 CATGCTGACAGAAGAAAGGATGG + Intronic
917270542 1:173268180-173268202 AATGGTAACAGGAGAAGGCTGGG + Intergenic
918344349 1:183593239-183593261 AGTGGTGACAGGAGAAGGGGAGG - Intronic
919367760 1:196685998-196686020 CATGGTGGAAGGTGAAGGGGAGG + Intronic
919370434 1:196717883-196717905 CTTTGTGACAGGAGATGGGAAGG + Intronic
919935476 1:202247957-202247979 CCTGATGAGAGAAGAAGGGTCGG + Intronic
920691901 1:208153711-208153733 CAGGGTAAGAGGAGAAGGGAGGG + Intronic
922593227 1:226794613-226794635 CAGAGAGAGAGGAGAAGGGTAGG + Intergenic
922675106 1:227544855-227544877 CTTGGGGCCAGGACAAGGGTGGG - Intergenic
924087956 1:240473015-240473037 CATGTTGGCAGGGGCAGGGTGGG + Intronic
1063874660 10:10461492-10461514 CATCCTGACAGAAGAAGGATGGG + Intergenic
1064021609 10:11813723-11813745 CCTGGTGACAGGAGCTGGGAAGG - Intergenic
1064319940 10:14295624-14295646 CATGGTGAGAGGAGATGAGGAGG + Intronic
1064457834 10:15505073-15505095 CATGGTGACAGTAGAGGTGAAGG + Intergenic
1066044338 10:31582897-31582919 CCAGGTGACAGGAGCAGGGAAGG - Intergenic
1067581532 10:47449618-47449640 CATGGGGACAGCATAAGGCTGGG + Intergenic
1068131163 10:52896940-52896962 GAGGGTGACAGGAGGAGTGTGGG + Intergenic
1069606634 10:69743049-69743071 CATGGTGGCAGGAGTGGGGAGGG - Intergenic
1069825591 10:71253358-71253380 CATGGTGTCGGGGGAAGGGAAGG - Intronic
1070140535 10:73734441-73734463 CAGGGTCAAAGGAGAAGGGAGGG - Intergenic
1070162835 10:73876144-73876166 GGTGGGGACAGGAGAAGGGATGG - Intergenic
1071019124 10:81031043-81031065 CATGAAGACAGCAGATGGGTGGG - Intergenic
1072932087 10:99674129-99674151 CAAGGAGACAGGAGAGGGGAAGG + Intronic
1073101470 10:101008876-101008898 CAGGGTGACATGAGGAGGGAGGG - Intronic
1073108645 10:101047869-101047891 TAAGGTGACAGGAGTTGGGTGGG - Intergenic
1073461179 10:103666869-103666891 GCAGGTGCCAGGAGAAGGGTGGG + Intronic
1073474948 10:103746733-103746755 CAGAGTGACAGGAGATGGGCGGG - Intronic
1074406604 10:113184896-113184918 AATTGAGACAGGAGAAGGGGAGG + Intergenic
1075668033 10:124244664-124244686 AAAGGGGACAGGAGATGGGTGGG - Intergenic
1075778267 10:125001748-125001770 CTTGGTGTCAGGAGCAGGGCTGG - Intronic
1075934963 10:126332549-126332571 CAGGGTGACAGCAGAATGGCTGG + Intronic
1076242979 10:128923912-128923934 CATGGAGACAGAAGAAGAGAAGG - Intergenic
1076324990 10:129614123-129614145 CATAGAGACAGTAGAAGGGTGGG - Intronic
1076361469 10:129892263-129892285 CAAGGAAACAGGAGAGGGGTAGG + Intronic
1076472719 10:130729981-130730003 CATGGGACCAGGGGAAGGGTTGG - Intergenic
1076788608 10:132764560-132764582 CATGGTGACAGGAACACGGCCGG + Intronic
1076856604 10:133118478-133118500 CATGGTGGAAGGTGAAGGGGAGG + Intronic
1077030077 11:461554-461576 CATGCAGCCAGGAGCAGGGTAGG - Intronic
1077116532 11:887671-887693 CATGGGCACAGGGGAGGGGTTGG - Intronic
1077225148 11:1436331-1436353 CTTGGAGGCAGGAGAAAGGTGGG - Intronic
1077337348 11:2011303-2011325 CACGGAGACAGGAGCAGGGCTGG + Intergenic
1078390455 11:10931690-10931712 CAAGGGGACAGGGGAGGGGTGGG + Intergenic
1078418757 11:11189258-11189280 CGTGGTGAAAGGTGAAGGGGAGG + Intergenic
1078622896 11:12925342-12925364 CATGGTGGCAGGAGAAAGGTGGG + Intronic
1078943091 11:16031531-16031553 CAAGGACACAGGAGTAGGGTAGG + Intronic
1080725634 11:34897702-34897724 CATGGTGACAAGAAGAGGGTGGG - Intronic
1082775845 11:57243909-57243931 AAGGGTGACAGGAGGTGGGTGGG - Intergenic
1082866022 11:57900849-57900871 CTTGGTGCTAGGAGAAGTGTGGG + Intergenic
1083855903 11:65392981-65393003 CAAGGTGGCAGGAGCAGAGTGGG + Intronic
1084287680 11:68142491-68142513 CAGGGTGAGGGGAGCAGGGTGGG + Intergenic
1084450139 11:69231873-69231895 CCAGGTGACAGGAGGAGGATGGG + Intergenic
1084782192 11:71417591-71417613 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1085262984 11:75218948-75218970 CATGGAGACAGCACAAGGGAGGG + Intergenic
1085704908 11:78778276-78778298 CAGGGTGACATGAGATGGGGTGG + Intronic
1087477965 11:98661419-98661441 GTAGGTGACAGGAGAAGGGAGGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1089581943 11:119486913-119486935 CTTGGTGCCAGGAAAAGGGATGG + Intergenic
1202820332 11_KI270721v1_random:66485-66507 CACGGAGACAGGAGCAGGGCTGG + Intergenic
1092575194 12:9775026-9775048 CAAGCAGACATGAGAAGGGTGGG - Intergenic
1093134540 12:15434999-15435021 CACCTTGAGAGGAGAAGGGTAGG - Intronic
1094069586 12:26398029-26398051 GATGATGACAGGAGAAGGGGAGG + Intronic
1095645448 12:44540548-44540570 CATGGTGGGAGGAGATGAGTAGG - Intronic
1096258056 12:50074719-50074741 AAGGGTGACAGTAGAGGGGTGGG + Intronic
1096588131 12:52637177-52637199 AAAAGTGACAGGAGGAGGGTGGG + Intergenic
1097038926 12:56142722-56142744 CATGTTGACAGGTAAAGGGCTGG + Exonic
1097181389 12:57173987-57174009 CCTGGTCCCAGGAGAAGGGTAGG + Intronic
1097182022 12:57177258-57177280 CATGGGGCCAGGAGAAGGCTGGG - Intronic
1099886996 12:88543681-88543703 AATGGTGATATGAGAAGGGCGGG - Intronic
1100080826 12:90847837-90847859 CATGGTGGAAGGCGAAGGGGAGG + Intergenic
1101345831 12:103885263-103885285 CATGGTGGGAGGGGGAGGGTGGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101709798 12:107254690-107254712 CATGGAAGCAGGAGAGGGGTGGG - Intergenic
1101763717 12:107680233-107680255 CATGGTGCCTGGTGCAGGGTGGG - Intergenic
1102215814 12:111160745-111160767 CTTGGTGACAGAAGATGGCTTGG + Intronic
1102589625 12:113947464-113947486 CCTGAGGACAGGAGAAGTGTCGG + Exonic
1103019422 12:117522074-117522096 CGTGGTGCCAGGAAAAGGCTGGG + Intronic
1103397886 12:120622075-120622097 CATGGTGAGAAGAGAAGTGGAGG + Intergenic
1104048617 12:125181617-125181639 CATGGTGGGTGGAGAAGGGATGG + Intergenic
1105015335 12:132783335-132783357 CATGGCCCCAGGAGAAGGCTGGG - Intronic
1105533528 13:21242741-21242763 CACGGGGACAGGAGAACAGTGGG - Intergenic
1105552620 13:21411564-21411586 AATGTTGAGTGGAGAAGGGTAGG - Intronic
1105706641 13:22971434-22971456 CATGGAGACAGAAGAACAGTTGG - Intergenic
1106131936 13:26948225-26948247 GAGGGTGTCTGGAGAAGGGTGGG + Intergenic
1107814589 13:44233021-44233043 CCTGGTGCCAGCAGAAGGGTGGG - Intergenic
1108245666 13:48510640-48510662 CACAGTGACAGGAGTAGGATAGG + Exonic
1108704667 13:52974406-52974428 GATGGTGATATGAGAAGGGCAGG + Intergenic
1108778944 13:53803553-53803575 CACTGTGACAGGGGAAGGATTGG - Intergenic
1108908608 13:55512927-55512949 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1109057136 13:57565003-57565025 CATGGTGACAGAAGAAGCAAGGG - Intergenic
1109105792 13:58249376-58249398 CATGGAGACAGGAGAAAGGGTGG + Intergenic
1111014224 13:82355926-82355948 CATGGTGCTAGCAAAAGGGTAGG - Intergenic
1111468849 13:88649734-88649756 CATGTTGACAGGCCCAGGGTGGG - Intergenic
1112323570 13:98428657-98428679 CAGGGTGGAAGGTGAAGGGTTGG - Intronic
1112429935 13:99342523-99342545 CATAGTGGCAGGAGATAGGTCGG + Intronic
1113433759 13:110272853-110272875 GATGGTGACAGGTGAAGGGTCGG - Intronic
1114198419 14:20499945-20499967 CATGGGAACAGCAGAAGGGAAGG - Intergenic
1114729099 14:24972092-24972114 AATGGGGGCAGGAGAAGGGCAGG - Intronic
1115466926 14:33725593-33725615 TATGGTGACATGAGAGAGGTAGG - Intronic
1115540682 14:34417669-34417691 CATGGTGGAAGGTGAAGGGGAGG + Intronic
1119125021 14:72117434-72117456 CATGGTGAAAGGTGAAGGGTGGG - Intronic
1120210356 14:81628239-81628261 CATGGAGACAGAAGAAGGGTGGG - Intergenic
1120229951 14:81831084-81831106 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1121578990 14:95012226-95012248 CATGGTTGCATGAAAAGGGTAGG + Intergenic
1122036012 14:98949910-98949932 CATGGTCACAAGAGAGGGGCCGG + Intergenic
1122147749 14:99703329-99703351 GAGGGAGACAGGAGGAGGGTAGG - Intronic
1125153820 15:36563626-36563648 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1125599260 15:40906636-40906658 CGCGGTGACAGGAGAAGGGAGGG - Intergenic
1125610146 15:40964162-40964184 GAGGGTGGCAGGAGAAGGGAAGG + Intergenic
1130652424 15:85769627-85769649 CACGGTGACAGGGGAAGGCACGG + Exonic
1131632634 15:94195482-94195504 CATGGTGACAGGTCAAAGTTTGG - Intergenic
1131800795 15:96067652-96067674 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1131867919 15:96731528-96731550 GATGGGGATAGCAGAAGGGTAGG - Intergenic
1132978706 16:2723418-2723440 CATGGTGAAAGGAAGAGGGAAGG + Intergenic
1135824907 16:25718109-25718131 CATAAGGACAGGAGCAGGGTTGG + Intronic
1137510501 16:49095509-49095531 GATGGTGACAGAAGCAGGGAGGG + Intergenic
1139466703 16:67157919-67157941 CATGATTATAGGAAAAGGGTGGG - Intronic
1141046679 16:80721812-80721834 CATGGCACCAGGAGAAGGATGGG - Intronic
1141148006 16:81545330-81545352 CATGGTGCCTGGAAGAGGGTGGG + Intronic
1141863817 16:86736116-86736138 CATGGTGACAGTAAGAGGATAGG - Intergenic
1143539030 17:7558648-7558670 CATTGTGCCAGGAGCAGGATGGG - Exonic
1144276004 17:13668397-13668419 CATGGTGGTAGTAGCAGGGTGGG - Intergenic
1144508645 17:15856268-15856290 CAAGGTGGCAGGAGGAAGGTGGG - Intergenic
1144664072 17:17090318-17090340 CATGAGGACAGGGGACGGGTTGG - Intronic
1144877726 17:18411140-18411162 CGTTGGGAAAGGAGAAGGGTCGG - Intergenic
1145154495 17:20533248-20533270 CGTTGGGAAAGGAGAAGGGTCGG + Intergenic
1145172764 17:20673908-20673930 CAAGGTGGCAGGAGGAAGGTGGG - Intergenic
1146630796 17:34467921-34467943 CATGGTGAGAGGTGAGTGGTGGG - Intergenic
1146809335 17:35890752-35890774 CAAGGTGACAGAAGAGGGGAGGG - Intergenic
1147327420 17:39676180-39676202 CATGGGGAGAGGAGCAGGCTTGG + Intronic
1147359571 17:39922505-39922527 CAGGGTGGCAGGGGAGGGGTAGG - Exonic
1147446550 17:40478442-40478464 CAGGGTGACAGAATGAGGGTAGG - Intronic
1148115092 17:45170840-45170862 CAGGGTGTCTGGGGAAGGGTGGG - Intergenic
1151780792 17:76243836-76243858 AAGGGAGAAAGGAGAAGGGTGGG + Intergenic
1152261658 17:79270477-79270499 CCTGGGTACAGGAGAAGGGGAGG - Intronic
1152825494 17:82462186-82462208 CAGGGTGAGAGGAGTTGGGTTGG + Intronic
1153261106 18:3225388-3225410 CCTGTTCACAGGAGAAGGGAGGG + Intergenic
1154949015 18:21190302-21190324 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1155661400 18:28253255-28253277 CATGGAGAAAGGCGAAGGGGAGG - Intergenic
1156253393 18:35373689-35373711 CATGGACACAGGAAAAGGGAGGG + Intronic
1156558410 18:38093340-38093362 CATGGAGCCAGGATAAGAGTTGG + Intergenic
1156928967 18:42617916-42617938 CAAGGAGACAGGAGACAGGTTGG - Intergenic
1157050309 18:44155862-44155884 CATGGTGACAGGATAGAGGAAGG - Intergenic
1157490463 18:48120262-48120284 CAGGGTGACAGGAGATGAGGTGG + Intronic
1157893122 18:51437762-51437784 CAGGGAGACAGGGGAAGGGGAGG + Intergenic
1158101699 18:53836605-53836627 CATGGTGAAAGGACAAGGTCTGG - Intergenic
1158256880 18:55561024-55561046 CATGAAGACAGGTGAAGGATGGG - Intronic
1158756041 18:60326753-60326775 GATGTTGACAGGAAATGGGTTGG - Intergenic
1158768800 18:60489561-60489583 CATGGTGACAGGAGGTTGGGGGG + Intergenic
1158810591 18:61029266-61029288 CATGGTGAAAGGTGAAGGAGAGG - Intergenic
1159141393 18:64399550-64399572 CATGGTGTCAGGCAAATGGTAGG + Intergenic
1160035462 18:75297595-75297617 CATGCTCAAAGGAGAGGGGTGGG - Intergenic
1160064307 18:75560970-75560992 CATGCTGAGAGGAGAATTGTGGG - Intergenic
1161662330 19:5554535-5554557 CAGGGTGAAAGGTGAAAGGTTGG + Intergenic
1161809647 19:6464586-6464608 CCTGGGGACAGGAGAAGGAGAGG - Exonic
1162305069 19:9867447-9867469 CCTGGGGACAGGAGAAGCATTGG + Intronic
1162470010 19:10867165-10867187 CACAGAGACAGGAGAATGGTGGG - Intronic
1162488697 19:10978206-10978228 CATGCTGACAGAGGAAGGGAAGG - Intronic
1162514246 19:11138675-11138697 CCTGGGGACAGGAGAAGGGGAGG - Intronic
1162526675 19:11210402-11210424 CAAGGAGACAGGTGAAGGGATGG - Intronic
1162969160 19:14169787-14169809 CATTGTGGGAGGAGAAGGGAAGG + Intronic
1163030306 19:14539804-14539826 CAGGGTGACAGGCAAGGGGTTGG - Intronic
1164402527 19:27911620-27911642 TATGGGGTCAGGAGAGGGGTGGG + Intergenic
1164473464 19:28554836-28554858 CATGTGGAGAGGAGCAGGGTAGG - Intergenic
1165250803 19:34532202-34532224 CATCATGGCAGGGGAAGGGTTGG - Intergenic
1165802561 19:38561956-38561978 CGTGATGACTGGTGAAGGGTGGG - Intronic
1166010872 19:39941697-39941719 CACCGTGAAAGGAAAAGGGTAGG + Intergenic
1168589183 19:57618536-57618558 CTGGCTGATAGGAGAAGGGTTGG + Intronic
925140026 2:1543903-1543925 CATGGTGGAAGGGGCAGGGTAGG + Intergenic
925234962 2:2270017-2270039 GATGGTGTCAGGAGGTGGGTGGG + Intronic
925573716 2:5338181-5338203 CATGGTGGAAGGGGAAGGGGAGG + Intergenic
926626535 2:15095336-15095358 CATGGTGGAAGGAGAAAGGCAGG + Intergenic
926702072 2:15810431-15810453 CATCGTGGCAGGTGACGGGTTGG + Intergenic
928660998 2:33501734-33501756 CATGGAGACATGAGAACCGTTGG + Intronic
929961085 2:46496798-46496820 CAGTGTGACAGGAGGAGGGCAGG + Intronic
930116574 2:47723272-47723294 CATGGAAATAGCAGAAGGGTTGG - Intronic
930441370 2:51411624-51411646 CATGGGGAATGGAGAAGGGGGGG - Intergenic
931899234 2:66769593-66769615 CCTGGTGTCAAGAGAAGGGCAGG - Intergenic
932288495 2:70555374-70555396 CTGGGGAACAGGAGAAGGGTGGG - Intergenic
932605516 2:73163086-73163108 CACGGGGTCAGGGGAAGGGTAGG + Intergenic
933622530 2:84559576-84559598 TATGGTAACAGGAAAAGAGTTGG - Intronic
934118391 2:88816702-88816724 CATGGCAACAGGAGAGAGGTGGG - Intergenic
934758918 2:96842751-96842773 CCTGCTGACAGGAGCAGGGTAGG - Intronic
937869294 2:126776405-126776427 CATGAAGCCAGGAGAAGGGCAGG + Intergenic
939407140 2:141772914-141772936 CAAGGAGACAGGAGAACTGTGGG - Intronic
940755682 2:157679263-157679285 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
941070800 2:160952264-160952286 CATGGAGACTAGAGAAAGGTTGG - Intergenic
942043224 2:172084645-172084667 CATGGGGAGTGGAGAAGGGAGGG + Intergenic
944090136 2:195898944-195898966 CATGGTGGTAGGAGAAGCTTTGG - Intronic
944487224 2:200219590-200219612 AATATTGACAGGAGTAGGGTAGG - Intergenic
947390548 2:229635146-229635168 CATGGGGAGAGGGGAAGGGAGGG - Intronic
948787682 2:240361421-240361443 CAAGGAGAATGGAGAAGGGTGGG + Intergenic
949043703 2:241860716-241860738 CAGGGAGAGAGGAGAGGGGTGGG - Intergenic
1168930696 20:1620961-1620983 CATGGTGCCAGGTGAAGAGAGGG + Intergenic
1168938380 20:1687420-1687442 CATGGTGCCAGGTGAAGAGAAGG + Intergenic
1170584305 20:17722890-17722912 GATGGGGACAGGAGAGGGGATGG + Intronic
1171108911 20:22462595-22462617 TATGGGGAGAGCAGAAGGGTGGG - Intergenic
1171125494 20:22598475-22598497 CATGGTGGCAGGTGGAAGGTAGG + Intergenic
1171303437 20:24084242-24084264 CAAGATGAGAGGAGAAGGGATGG - Intergenic
1171823982 20:29878179-29878201 GAGGCTGACGGGAGAAGGGTTGG + Intergenic
1173442621 20:43091771-43091793 CATGGTCCCAGGAGGAAGGTAGG + Intronic
1174156457 20:48518652-48518674 CATTGAGACAGGAGAGGGGCAGG + Intergenic
1174865297 20:54129954-54129976 CATTGTGACAGCAGAAGGCGGGG + Intergenic
1175274914 20:57761826-57761848 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1175776925 20:61659523-61659545 CTTGGAGACAGGAGGAGGGTGGG + Intronic
1175776937 20:61659562-61659584 CTTGGAGGCAGGAGGAGGGTGGG + Intronic
1175776948 20:61659601-61659623 CTTGGAGGCAGGAGGAGGGTGGG + Intronic
1175776958 20:61659640-61659662 CTTGGAGGCAGGAGGAGGGTAGG + Intronic
1175776969 20:61659679-61659701 CTTGGAGGCAGGAGGAGGGTGGG + Intronic
1175776981 20:61659718-61659740 CTTGGAGGCAGGAGGAGGGTGGG + Intronic
1175899470 20:62354354-62354376 CAGGGTGTCAGGGGATGGGTAGG - Intronic
1178920106 21:36733091-36733113 CATGGAGGCAGGAGAATGCTGGG + Intronic
1179296618 21:40068678-40068700 CATGGCAAGAGGAGTAGGGTAGG + Intronic
1179392652 21:41008128-41008150 CATGGGGACAGGAGGTGAGTGGG + Intergenic
1180155548 21:45975517-45975539 CGTGGTGATAGGAGAGGGGGTGG + Intergenic
1181038157 22:20179686-20179708 CATGGGGACAGGGGCAGGATGGG + Intergenic
1182795943 22:32991836-32991858 TGTGGTGGCAGGAGAAGGGATGG - Intronic
1184081746 22:42226181-42226203 AAAGGGGGCAGGAGAAGGGTGGG + Intronic
1184316196 22:43691887-43691909 CATGCTAACAGGAGAACTGTGGG + Intronic
1184381112 22:44145443-44145465 CAGGTTGACAGGAAGAGGGTCGG - Intronic
1184497262 22:44849164-44849186 GATGGCAACAGGAGGAGGGTGGG - Intronic
1184686720 22:46099571-46099593 CGTGGGGACAGGAGAGGGGCAGG + Intronic
1184996311 22:48209864-48209886 CAGGGTGGCAGGGGAAGGGTTGG + Intergenic
949426234 3:3919229-3919251 AATGGTGGCAGGAGAATAGTGGG - Intronic
949859128 3:8489643-8489665 CATTGTGACAGGAAAAGAATGGG - Intergenic
950333653 3:12176959-12176981 CATGGTGAAAGGGGAGGGCTGGG + Intronic
950436487 3:12983473-12983495 CAGGGTGACAGGTGGTGGGTGGG - Intronic
950913085 3:16615427-16615449 CATGGTGGCAGGTGAAGGGGAGG - Intronic
951992027 3:28685663-28685685 CATGGTGACTGGAGAACATTTGG + Intergenic
952310694 3:32186587-32186609 CCTGGTTTCAGGAGAAGCGTGGG - Intergenic
953533244 3:43756868-43756890 CATGGGGACAGGAGAAAGGTGGG - Intergenic
955101141 3:55851227-55851249 CATGGTAACAGGACAACAGTGGG + Intronic
955395300 3:58553074-58553096 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
956969532 3:74506446-74506468 CAGGGTGGGAGGAGATGGGTTGG + Intronic
959244410 3:103846088-103846110 CAGGGTGAGGGGATAAGGGTAGG + Intergenic
959294189 3:104514259-104514281 TACGGTGGCAGGATAAGGGTGGG + Intergenic
959917741 3:111836744-111836766 CATGGTGACAGGAGGTGAGGGGG + Intronic
961646259 3:128394276-128394298 CTTGCTGACAGGGGAAGGGCAGG - Intronic
961810528 3:129519227-129519249 CATGTGCACAGGAGAAGGGATGG - Intronic
963323883 3:143839943-143839965 TATGGTGAAAGGGGGAGGGTTGG - Intronic
964844353 3:161029722-161029744 AAGGGTGACAGTAGAGGGGTAGG - Intronic
966278772 3:178206536-178206558 CAAGGTTTCAGGGGAAGGGTTGG - Intergenic
966822971 3:183939853-183939875 CATGGTGGCACGAGAAAGGTAGG - Intronic
967884906 3:194326416-194326438 CATGGTTAAAGGAAAAGGTTCGG + Intergenic
968070223 3:195780045-195780067 GATGGTGACAGGAAGAGGGGTGG + Exonic
968070303 3:195780477-195780499 GATGGTGACAGGAAGAGGGGTGG + Exonic
968529977 4:1086590-1086612 GAGGGTGGCAGGAGAGGGGTGGG + Intronic
968727454 4:2254808-2254830 CAGGCTGACATGAGAAGGGATGG + Intronic
969177305 4:5408408-5408430 CATGGTGAAAGGCGAAGGGGAGG - Intronic
969211086 4:5687713-5687735 CTAGGAGATAGGAGAAGGGTAGG + Intronic
969896659 4:10311698-10311720 TATGGGGTCAGGAGAAGTGTGGG + Intergenic
969966576 4:11002983-11003005 CATGGTGGAAGGTGAAGGGGGGG + Intergenic
971499472 4:27302643-27302665 CATTCTAAAAGGAGAAGGGTAGG + Intergenic
971991810 4:33908348-33908370 CATGGTGAAAGGTGAAAGGGAGG + Intergenic
972117071 4:35649896-35649918 CTTGGTGACAGGAAGAGAGTGGG - Intergenic
972226756 4:37022090-37022112 CATAGTGAAAGGAGGAGGGCTGG + Intergenic
973958632 4:56087970-56087992 CATGGTGACAGAAGGAGAGATGG - Intergenic
975713925 4:77187685-77187707 CATGGTAAAAGGAGCAGGGGAGG - Intronic
976069298 4:81223030-81223052 CATGGTGGCAGGAGACAGATTGG + Intergenic
976287706 4:83386130-83386152 CATGGTGGCAGGGGAAGGAGGGG + Intergenic
977466544 4:97389482-97389504 CATGGTGGAAGGAAAAGGGGAGG + Intronic
977842423 4:101724753-101724775 CATGGTTACATGAGAGGGGAGGG + Intronic
978405584 4:108375473-108375495 CATGTTGAGATAAGAAGGGTGGG - Intergenic
978414703 4:108463367-108463389 AATGCTGGGAGGAGAAGGGTGGG + Intergenic
978492584 4:109324431-109324453 CATGGTGGCAGGAGAAAGAGAGG + Intergenic
981178701 4:141714097-141714119 GATGGGGACAGGAGGAGGATGGG - Intronic
985199547 4:187470740-187470762 CATGGTGCCAGGAGAAGGTGAGG - Intergenic
986310146 5:6545381-6545403 CGAGGTCACAGGAGCAGGGTAGG - Intergenic
986402393 5:7394712-7394734 GCTGGTGGCAGGAGAAGGGAGGG + Intergenic
988787090 5:34575108-34575130 GCTGGTGGCAGGAAAAGGGTTGG - Intergenic
990131828 5:52595575-52595597 CATGGTGAAAGCAGAAGAGAGGG - Intergenic
990328974 5:54706767-54706789 AGTGGTGAGAGGAGATGGGTAGG - Intergenic
990416645 5:55593397-55593419 CATGGAGGCAGGACTAGGGTTGG - Intergenic
990477603 5:56176109-56176131 CAGGGTGGAAGGAGCAGGGTAGG - Intronic
990805281 5:59653877-59653899 GAAGGGGAGAGGAGAAGGGTGGG + Intronic
991222793 5:64235810-64235832 CATGGTGACAGGAGAAAGAAGGG - Intronic
991354260 5:65751217-65751239 CATGGTGACAGGGAAAGGGATGG + Intronic
991431202 5:66549373-66549395 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
993724864 5:91355693-91355715 CATTGTGAGAGCTGAAGGGTTGG + Intergenic
993762913 5:91818927-91818949 TATGGGGTCAGGAGAATGGTTGG + Intergenic
993884399 5:93398850-93398872 CATGGAGACAGGAGAAGGGCTGG + Intergenic
994044034 5:95287624-95287646 CCGGGTGAAAGCAGAAGGGTTGG + Intergenic
994147122 5:96408122-96408144 CATGGTTACAGGAGAAATTTTGG - Intronic
994666883 5:102716018-102716040 CATGAGGAGAGGAGAAGGGAAGG + Intergenic
997601496 5:135141684-135141706 CATCGTGACAGGAAAGGGGCAGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
998805897 5:145917746-145917768 CATGGAGACAGGTGAGTGGTGGG - Intergenic
999197805 5:149794645-149794667 CTTTGAGGCAGGAGAAGGGTGGG + Intronic
999621945 5:153482651-153482673 CATTGGGATAGAAGAAGGGTGGG + Intergenic
999829906 5:155308437-155308459 CACTGTGACAGGAGGATGGTGGG + Intergenic
999917111 5:156274834-156274856 CAGGGTCACAGGAGAAGAGGAGG - Intronic
1000008859 5:157213140-157213162 CATGGTGGAAGGTGAAGGGGAGG + Intronic
1000112070 5:158117747-158117769 GAGGGTGACAGGAGACAGGTTGG + Intergenic
1000903694 5:166937388-166937410 CATGGTGACAAGAGAGGCATTGG + Intergenic
1002653668 5:180724192-180724214 GATGGGGACAGGAGAGGGGAGGG - Intergenic
1003116116 6:3284817-3284839 CCTGGTGCCAGGGGAAGGGGCGG + Intronic
1003377568 6:5593792-5593814 CATGGGGACAGGAAGATGGTCGG + Intronic
1003688022 6:8323712-8323734 CAGTGTGGCAGGAGAAGGGCAGG - Intergenic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1005809786 6:29506794-29506816 TATGGGGACAGCAGCAGGGTTGG - Intergenic
1005953866 6:30649877-30649899 CGGGGTGGCAGGGGAAGGGTGGG - Exonic
1007259745 6:40555263-40555285 CCTGGTGAGAGGTGAAGGCTGGG + Intronic
1007292358 6:40797316-40797338 CAAGGGGACAGGAGAAGGCCGGG - Intergenic
1007905599 6:45457404-45457426 TAGGGTGACTGGAGAAGGGAAGG + Intronic
1008691420 6:53983406-53983428 CATGGTGGAAGGTGAAGGGAAGG + Intronic
1009241604 6:61192756-61192778 CATGCTGACTGCAGCAGGGTGGG + Intergenic
1010163914 6:72893108-72893130 CATGCTGCCAGCAGAAGAGTAGG + Intronic
1011419331 6:87155396-87155418 CAAGGGGAAAGGAGAAGGGCGGG - Intronic
1011515284 6:88146488-88146510 CCTGGTGACAGGAGACAGGCTGG + Intronic
1011661628 6:89599758-89599780 CTTGGTTACTTGAGAAGGGTGGG + Intronic
1013044587 6:106471656-106471678 CAAGGTGACAGGTGGAGTGTGGG + Intergenic
1013113191 6:107080438-107080460 TATGGTGACTGGAGTAGGGTGGG - Intronic
1015938116 6:138423238-138423260 CATAGAGAGAGGGGAAGGGTTGG - Exonic
1015984485 6:138871850-138871872 TATGGTAACAGCAGAAGGGTAGG - Intronic
1017727146 6:157283688-157283710 CTGGGTGTCAGGCGAAGGGTGGG + Intergenic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1018138756 6:160805880-160805902 GATGGTGACAGAAGCTGGGTAGG + Intergenic
1018949384 6:168369268-168369290 CATGGTGTGGGGAGCAGGGTGGG - Intergenic
1018999345 6:168735657-168735679 CATGGTCAGGGTAGAAGGGTTGG + Intergenic
1019024886 6:168951094-168951116 TAAGGGGACAGGAGCAGGGTGGG + Intergenic
1019304261 7:325416-325438 CATCGTGGAAGGAGAAGGGTGGG - Intergenic
1019370394 7:660166-660188 CATGGAGCCGGGAGAAGGCTGGG - Intronic
1019424605 7:968406-968428 GATGGTGGCAGGAGACGGGGTGG - Exonic
1019432492 7:1005718-1005740 CATGGGGACCTGAGGAGGGTGGG + Intronic
1019831286 7:3333652-3333674 CATGGGTACAAGAGAAGGGAAGG - Intronic
1019975061 7:4574506-4574528 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1020009942 7:4802246-4802268 CGGGAGGACAGGAGAAGGGTTGG - Intronic
1021165803 7:17339075-17339097 CATTATGGCAGGAAAAGGGTTGG - Exonic
1021817447 7:24461604-24461626 AATGGTGGCAGGGGGAGGGTCGG - Intergenic
1022043425 7:26602520-26602542 CTTGGTGACAGGATCATGGTGGG - Intergenic
1023852997 7:44160540-44160562 CACTGAGACAGGACAAGGGTGGG - Intronic
1023895038 7:44426279-44426301 CCTGGGGAAAGGAGAATGGTTGG + Intronic
1023947051 7:44811490-44811512 CATAGTGACAGGAGGAGGGAGGG - Intronic
1024048569 7:45601831-45601853 GATGGTGCCAGGAGAAGGGAAGG + Intronic
1025853848 7:65262170-65262192 AATGGTGACCTGAGAGGGGTGGG + Intergenic
1026145394 7:67742096-67742118 CATGGTGACAGGAGAGAGAGAGG - Intergenic
1026334190 7:69379652-69379674 CTCGATGACAGGAGACGGGTGGG + Intergenic
1027049857 7:75015107-75015129 CATGGTGACCGGAGCTGGGCAGG + Intronic
1029060837 7:97796716-97796738 TGTGGTCACAGGGGAAGGGTTGG - Intergenic
1030878794 7:114850199-114850221 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1032282436 7:130515280-130515302 CATGGCGGCAGGTGAATGGTGGG + Intronic
1032691033 7:134286869-134286891 CATGGTGGCAGGAGAAAGAGAGG - Intergenic
1033169858 7:139073937-139073959 CTTGGTGACAGAAGAAGGAGTGG + Exonic
1033632076 7:143168664-143168686 CATGGTGGCAGGAGAGAGCTAGG + Intergenic
1033657557 7:143383329-143383351 GATGGTGATAGGACAAGGCTTGG + Intronic
1034532127 7:151702405-151702427 CATGCTGACAGCAGACGGATGGG + Intronic
1034652380 7:152701697-152701719 CAGGGAGACTGAAGAAGGGTGGG - Intergenic
1035706671 8:1680901-1680923 CATGCTGACAGGGGCAGCGTAGG + Intronic
1037963225 8:23115330-23115352 GCTGGTGACAGCTGAAGGGTGGG + Intronic
1037974897 8:23202082-23202104 GTTGGTGACAGCTGAAGGGTGGG - Intronic
1039477067 8:37844668-37844690 CAGGGTGGCAAGAGAAGGGCAGG + Exonic
1039720579 8:40160025-40160047 CATGGTGGCAGGAGAGAGGGAGG - Intergenic
1040856499 8:51953987-51954009 CATGGTGGCAGGAGAAAGGGAGG - Intergenic
1041253135 8:55954021-55954043 GATGGTGACAGGAGAAGTAAAGG + Intronic
1044710366 8:95051534-95051556 CATGGAGACAGGAGTGGGCTTGG + Intronic
1045057844 8:98384730-98384752 CATGGGGCCAGCAGGAGGGTGGG - Intergenic
1045790298 8:105976227-105976249 CTTGGTGACAGGTTATGGGTTGG + Intergenic
1046268890 8:111866959-111866981 CATGGAGATATCAGAAGGGTAGG - Intergenic
1046374893 8:113364290-113364312 CATGGGGACAGGAACAGGGATGG + Intronic
1046692282 8:117299188-117299210 CATAGTGAAAGGAGGAGGGAGGG - Intergenic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1047271300 8:123361883-123361905 CATGGAGACAGGAGAAGGCAGGG + Intronic
1047533847 8:125701313-125701335 CATGGTGACAGAGGAAGTGATGG + Intergenic
1047582548 8:126232129-126232151 AGTGGGGAGAGGAGAAGGGTAGG + Intergenic
1047732791 8:127739928-127739950 CATGGTGAGAGGAGTAAGGGTGG + Intronic
1048424743 8:134312558-134312580 CATGGTGGAAGGCGAAGGGGAGG + Intergenic
1048564568 8:135581867-135581889 CTTGGTTACAGGGGAAGGGGAGG + Exonic
1049293334 8:141815905-141815927 CATGGTGACAGGACATGGCTTGG - Intergenic
1049672176 8:143874837-143874859 CAAGGTCTCAGGAGAAGGGTCGG + Intronic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1050757801 9:9029580-9029602 CATGGAGACAGGAAGAGGGAGGG + Intronic
1050803917 9:9650178-9650200 CATGGTGACAGGAGAGTGGTTGG - Intronic
1055398386 9:75897361-75897383 CATGGAGACAGGACAGGGGAGGG + Intronic
1055574073 9:77645573-77645595 CAAGGTGGTAGGAGGAGGGTTGG + Intronic
1056655290 9:88503769-88503791 CAGAGTGCCAGGAGAAGGGTAGG + Intergenic
1056708243 9:88969640-88969662 ACAGGTGACAGGAGAAGGGAGGG + Intergenic
1056819253 9:89825741-89825763 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1058272189 9:102986302-102986324 CCTAGTGCCAGGAGAAGGGAGGG + Intergenic
1058345081 9:103951393-103951415 GATGGTGAGAGGAAAGGGGTTGG - Intergenic
1058395847 9:104553112-104553134 GAGGGTGACAGGAGACTGGTAGG + Intergenic
1060768207 9:126310717-126310739 CATGGTGTCTGGAACAGGGTAGG + Intergenic
1060809041 9:126599217-126599239 CATGGTGGAAGGCGAAGGGGAGG + Intergenic
1061408061 9:130403497-130403519 CATGGTGACAGGAGAAGGGTTGG - Intronic
1061507031 9:131037191-131037213 CATGGAGACAGCAGCAGGCTGGG - Intronic
1061616400 9:131782647-131782669 CATGGTGACAGAAGAAGACAAGG - Intergenic
1062188174 9:135229640-135229662 CATGGAGACAGGTGGAGGGACGG - Intergenic
1186927823 X:14354650-14354672 CATGGTGACTGGGGAAGGGATGG + Intergenic
1187417594 X:19106447-19106469 CATGGAGAAAGGAGTGGGGTGGG - Intronic
1187932063 X:24302668-24302690 CAGGGTAACAGGAGAAGAGAAGG + Intergenic
1188019805 X:25144737-25144759 CAGCGAGACAGGAGGAGGGTGGG + Intergenic
1188630327 X:32349542-32349564 GAATGTGACTGGAGAAGGGTAGG - Intronic
1189096456 X:38145369-38145391 TATGGTGGCAGGACAAGGGGAGG - Intronic
1189155927 X:38756770-38756792 CATGGACACAGAAGAAGGGCTGG + Intergenic
1189729368 X:44002787-44002809 CAATGTGACAGGAAAGGGGTGGG - Intergenic
1190138967 X:47824452-47824474 CATGGTGAGAGAAGAAGGAAGGG + Intergenic
1190169717 X:48102348-48102370 CATGGTAAAAGGTGAAGGGGAGG - Intergenic
1190713174 X:53083651-53083673 GATGGTGAAAGGAGGAGGGGAGG + Intronic
1191715048 X:64188439-64188461 CATGGATGCAGGAGAAGGGAGGG + Exonic
1192271101 X:69580425-69580447 CATGGCTAGAGGAGAAGGGCTGG + Intergenic
1193190574 X:78565227-78565249 CATGGTGGCAGCAGCAGGGTAGG + Intergenic
1193732230 X:85115457-85115479 CCAGAAGACAGGAGAAGGGTTGG + Intergenic
1194409706 X:93543013-93543035 CATGGTGGAAGGTGAAGGGGAGG + Intergenic
1194479824 X:94407238-94407260 CATGGTGTCAGGTGCAGGATGGG + Intergenic
1195055265 X:101138306-101138328 TGTGGTGACAGGGGTAGGGTAGG + Intronic
1195242788 X:102968912-102968934 AATGGTGAAATGAGAAGGGATGG + Intergenic
1198134698 X:133737159-133737181 CATGGAGACAGTAAAAAGGTCGG + Intronic
1198183673 X:134234203-134234225 CGTGGTGAAATGAGAAGGTTGGG + Intergenic
1198445001 X:136704581-136704603 CATGGTGGAAGGAGAAGGAAAGG + Intronic
1202282892 Y:23208822-23208844 CATGGTGGAAGGTGAAGGGGAGG - Intergenic
1202434566 Y:24823207-24823229 CATGGTGGAAGGTGAAGGGGAGG - Intergenic