ID: 1061413517

View in Genome Browser
Species Human (GRCh38)
Location 9:130433364-130433386
Sequence TGCTCGCAGGACTGCGGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061413509_1061413517 3 Left 1061413509 9:130433338-130433360 CCGCCCGCAGGACGTGCTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413506_1061413517 21 Left 1061413506 9:130433320-130433342 CCTGTCCGTGTGTCTGTGCCGCC 0: 1
1: 0
2: 2
3: 7
4: 138
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413507_1061413517 16 Left 1061413507 9:130433325-130433347 CCGTGTGTCTGTGCCGCCCGCAG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413512_1061413517 -1 Left 1061413512 9:130433342-130433364 CCGCAGGACGTGCTTCCGGCGCT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413511_1061413517 0 Left 1061413511 9:130433341-130433363 CCCGCAGGACGTGCTTCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413505_1061413517 24 Left 1061413505 9:130433317-130433339 CCGCCTGTCCGTGTGTCTGTGCC 0: 1
1: 0
2: 4
3: 35
4: 308
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1061413504_1061413517 30 Left 1061413504 9:130433311-130433333 CCGAGTCCGCCTGTCCGTGTGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG 0: 1
1: 0
2: 0
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061413517 Original CRISPR TGCTCGCAGGACTGCGGCAC GGG Exonic