ID: 1061415232

View in Genome Browser
Species Human (GRCh38)
Location 9:130443999-130444021
Sequence GAGGACTCCCGGTCCTCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061415232_1061415241 17 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415241 9:130444039-130444061 TCACTATGGAGCAACTGCCTTGG No data
1061415232_1061415240 3 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415240 9:130444025-130444047 TCTGGGGTCAGTGCTCACTATGG No data
1061415232_1061415242 21 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415242 9:130444043-130444065 TATGGAGCAACTGCCTTGGATGG No data
1061415232_1061415244 23 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415244 9:130444045-130444067 TGGAGCAACTGCCTTGGATGGGG No data
1061415232_1061415245 30 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415245 9:130444052-130444074 ACTGCCTTGGATGGGGTCCCAGG No data
1061415232_1061415243 22 Left 1061415232 9:130443999-130444021 CCGGCTGAGGACCGGGAGTCCTC No data
Right 1061415243 9:130444044-130444066 ATGGAGCAACTGCCTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061415232 Original CRISPR GAGGACTCCCGGTCCTCAGC CGG (reversed) Intergenic
No off target data available for this crispr