ID: 1061416084

View in Genome Browser
Species Human (GRCh38)
Location 9:130447594-130447616
Sequence AAGGAGGGCTGGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061416067_1061416084 8 Left 1061416067 9:130447563-130447585 CCTTCCCTCCTCCCAGGTGTCTC 0: 1
1: 0
2: 3
3: 90
4: 711
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416074_1061416084 -3 Left 1061416074 9:130447574-130447596 CCCAGGTGTCTCTTCCGGGGAAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416066_1061416084 11 Left 1061416066 9:130447560-130447582 CCACCTTCCCTCCTCCCAGGTGT 0: 1
1: 0
2: 9
3: 90
4: 762
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416075_1061416084 -4 Left 1061416075 9:130447575-130447597 CCAGGTGTCTCTTCCGGGGAAGG 0: 1
1: 0
2: 2
3: 10
4: 145
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416072_1061416084 0 Left 1061416072 9:130447571-130447593 CCTCCCAGGTGTCTCTTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416068_1061416084 4 Left 1061416068 9:130447567-130447589 CCCTCCTCCCAGGTGTCTCTTCC 0: 1
1: 0
2: 4
3: 67
4: 498
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416069_1061416084 3 Left 1061416069 9:130447568-130447590 CCTCCTCCCAGGTGTCTCTTCCG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data
1061416064_1061416084 24 Left 1061416064 9:130447547-130447569 CCTTGACGCGAGGCCACCTTCCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061416084 Original CRISPR AAGGAGGGCTGGAGGGCAGT GGG Intronic
No off target data available for this crispr