ID: 1061418025

View in Genome Browser
Species Human (GRCh38)
Location 9:130458568-130458590
Sequence GTCCCACGGCGCCACAGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061418021_1061418025 1 Left 1061418021 9:130458544-130458566 CCAGCGGGAGGGGGCCAAGTATG 0: 1
1: 3
2: 4
3: 6
4: 84
Right 1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG 0: 1
1: 1
2: 2
3: 11
4: 76
1061418013_1061418025 22 Left 1061418013 9:130458523-130458545 CCGCAAACAAGTGGAAATCGCCC 0: 1
1: 4
2: 5
3: 4
4: 60
Right 1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG 0: 1
1: 1
2: 2
3: 11
4: 76
1061418020_1061418025 2 Left 1061418020 9:130458543-130458565 CCCAGCGGGAGGGGGCCAAGTAT 0: 1
1: 2
2: 6
3: 5
4: 40
Right 1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG 0: 1
1: 1
2: 2
3: 11
4: 76
1061418012_1061418025 23 Left 1061418012 9:130458522-130458544 CCCGCAAACAAGTGGAAATCGCC 0: 3
1: 3
2: 4
3: 7
4: 87
Right 1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG 0: 1
1: 1
2: 2
3: 11
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061418025 Original CRISPR GTCCCACGGCGCCACAGGAA AGG Exonic
900418306 1:2545067-2545089 TTCCCACAGCCCCACAGAAAGGG + Intergenic
902729914 1:18362540-18362562 GTCCCACGGAGACAAATGAAAGG + Intronic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
904051939 1:27645203-27645225 GACCCATGGAGCCACAGGACAGG + Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
908774579 1:67627766-67627788 AGCCCACGGAGGCACAGGAATGG - Intergenic
920019471 1:202943795-202943817 GTCCCACTGCGCCACAATGATGG + Exonic
922721595 1:227902768-227902790 GTCTGGCGGCGCCACAGGACAGG - Intergenic
923561897 1:235047823-235047845 GGCACAAGGAGCCACAGGAAAGG + Intergenic
1067183010 10:44004877-44004899 GTCCCACGTCTCCACAGTCAGGG + Intergenic
1070594102 10:77820428-77820450 CTCCCACTGGGGCACAGGAAGGG + Intronic
1074121866 10:110498910-110498932 GCACCACGGCGCCACACCAAGGG - Intronic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1083732115 11:64658043-64658065 GTCCCAAGGGCCCACAGGATAGG + Intronic
1085322535 11:75583680-75583702 GCCCCGCGGCGCCGCAGAAAGGG - Intergenic
1085691516 11:78667981-78668003 GTCCCAGGGTCCCACAGGCAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1102131862 12:110537758-110537780 GTCCCACAAAGCCAGAGGAAGGG + Intronic
1103905470 12:124325346-124325368 GTCCCAGCGAGCCACAGGAACGG - Exonic
1112290670 13:98142595-98142617 CTCCCCCGGAGCCACAGGCACGG - Exonic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1118990454 14:70792720-70792742 GTCCCAGGGTGCCACAGGTCTGG + Intronic
1123093237 14:105751383-105751405 GCACCACGGGGCCACAGGAGTGG - Intergenic
1132149153 15:99447411-99447433 GTCCCGCGGGCCCAGAGGAAGGG - Intergenic
1141897094 16:86965068-86965090 CTCCCCCGGAGCCCCAGGAAGGG - Intergenic
1142367797 16:89659238-89659260 CTCCCACTGGGCCACAGCAATGG - Intronic
1149544899 17:57496265-57496287 GCCCTACAGAGCCACAGGAATGG + Intronic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1158166783 18:54549050-54549072 GTCCCACTGAGGCACAGGATGGG - Intergenic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1160898158 19:1412504-1412526 GTCCCCCGGCCCAGCAGGAAGGG + Intronic
1161003559 19:1923401-1923423 GGCCCAGGGGGCCACAGGACTGG - Intronic
1163284472 19:16337956-16337978 GCCCCACGGACACACAGGAAGGG - Intergenic
1202668301 1_KI270709v1_random:20235-20257 GTCCCATTGTGCTACAGGAAGGG - Intergenic
925417157 2:3678373-3678395 GTCCCACAGTGCCAGAGGAACGG - Intronic
927256470 2:21044308-21044330 GCCCCACTGAGACACAGGAAGGG - Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
933804196 2:85986490-85986512 GTCCCAGCAGGCCACAGGAATGG - Intergenic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1179524071 21:41964328-41964350 GTCCCAGGAGGCCACAGGAGGGG + Intergenic
1184425333 22:44405937-44405959 GTCCCAGGGGGGCACAGGGAGGG - Intergenic
1185137033 22:49079068-49079090 TTCCCAGGAAGCCACAGGAAAGG + Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950055632 3:10022055-10022077 GCCCCAGGGCGCCACTGGAGCGG + Intergenic
950473580 3:13201672-13201694 GACCCACGGGGTCACAGGCATGG + Intergenic
961492440 3:127265008-127265030 GAGCTACGGCTCCACAGGAAGGG + Intergenic
962114321 3:132486240-132486262 GCCACATGGCCCCACAGGAAAGG - Intronic
965561054 3:170062748-170062770 GTCCCAAGGAGCTCCAGGAAGGG + Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967989836 3:195122612-195122634 GTCCTTCGACTCCACAGGAAGGG + Intronic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
969912107 4:10456898-10456920 GGCCAGCGGCGCCACACGAACGG + Intronic
976146189 4:82044405-82044427 GGCCAACGGCGCCTCAGGATGGG + Intergenic
980137761 4:128876388-128876410 GTCCCCAGGAGCCAAAGGAAGGG + Intronic
986461430 5:7976521-7976543 GTCCGAGAGAGCCACAGGAAGGG + Intergenic
989592688 5:43126429-43126451 GACCCAAGGCGGCAGAGGAAAGG - Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1015281080 6:131434377-131434399 GTCCCACTGGGACAAAGGAAAGG + Intergenic
1016890720 6:149004495-149004517 GGCCCATGGTGCCCCAGGAAGGG + Intronic
1018238486 6:161749623-161749645 GTACCATGGGGCTACAGGAAAGG - Intronic
1018374049 6:163194769-163194791 GGCCTACTGGGCCACAGGAATGG + Intronic
1019412219 7:911575-911597 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412234 7:911605-911627 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412249 7:911635-911657 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412264 7:911665-911687 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412279 7:911695-911717 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412294 7:911725-911747 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412309 7:911755-911777 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019412324 7:911785-911807 GTCCCACGGAGGGCCAGGAAGGG + Intronic
1019532180 7:1509323-1509345 GTCCACCGGAGCCACAGGATGGG - Intergenic
1026475169 7:70728976-70728998 CTCCCAAGGGGCCACATGAAAGG + Intronic
1033534697 7:142300898-142300920 CTCCCATGGCCCCACAGGCAAGG - Intergenic
1036015310 8:4776504-4776526 GTCTCAGGGCCCCATAGGAATGG + Intronic
1037581308 8:20247384-20247406 GCCCCACGGAGACAGAGGAAAGG - Exonic
1037625225 8:20600659-20600681 GACCCAGGAAGCCACAGGAAAGG + Intergenic
1049880803 8:145061208-145061230 GTCCTGAGGGGCCACAGGAATGG - Intergenic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1191927216 X:66326520-66326542 GTCCAATGGCTCCAGAGGAAGGG + Intergenic
1192843500 X:74881870-74881892 GTCCCTCTGAGCAACAGGAAAGG + Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic