ID: 1061418071

View in Genome Browser
Species Human (GRCh38)
Location 9:130458754-130458776
Sequence GCCACAGTGCACAGAGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061418071_1061418077 22 Left 1061418071 9:130458754-130458776 CCCTGCGCTCTGTGCACTGTGGC 0: 1
1: 0
2: 1
3: 30
4: 224
Right 1061418077 9:130458799-130458821 CTCACCTCCACCTTCTGCTGTGG No data
1061418071_1061418078 23 Left 1061418071 9:130458754-130458776 CCCTGCGCTCTGTGCACTGTGGC 0: 1
1: 0
2: 1
3: 30
4: 224
Right 1061418078 9:130458800-130458822 TCACCTCCACCTTCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061418071 Original CRISPR GCCACAGTGCACAGAGCGCA GGG (reversed) Intronic
900466860 1:2829995-2830017 GCCAGAGTGCACAGAGGCCCAGG - Intergenic
901333489 1:8428661-8428683 GCTACAGTGGAAAGAACGCAAGG + Intronic
901933783 1:12614443-12614465 GCCACAGTGCACTGTGGGTAAGG + Intronic
902559475 1:17267982-17268004 GCAACAGGGCACAGATGGCAAGG - Intronic
903180973 1:21604725-21604747 GCCTCACAGCACTGAGCGCAGGG + Intronic
903222975 1:21879076-21879098 GCCACAGTGCAACAAGTGCAAGG - Exonic
904009822 1:27383195-27383217 GCCACAGAGCGCAGTCCGCAAGG + Exonic
904042937 1:27594530-27594552 GCCAGGGTGCCCAGAGCACAGGG + Intronic
904450098 1:30605538-30605560 ACCACTGTGCACAGAGCACCAGG - Intergenic
905009384 1:34736913-34736935 TCCACACTGCACAGAGTGCCAGG + Intronic
906127657 1:43437415-43437437 GGCATTGAGCACAGAGCGCAGGG - Exonic
913015801 1:114733291-114733313 GCCAAGGTGGACAGATCGCAAGG + Intronic
913497126 1:119438694-119438716 GCCACAGTGCACAAAGCTCCAGG + Intergenic
914904062 1:151729541-151729563 GCGACAGTAGACAGAGCCCAAGG - Exonic
915323566 1:155069369-155069391 CCCACAGGGCACAGATGGCAGGG - Exonic
917953305 1:180064125-180064147 GCCAGAGTCCAAAGAGAGCAAGG - Intronic
919471155 1:197980599-197980621 GCCACAGAGCCCAGAGTGCCTGG + Intergenic
920295225 1:204951986-204952008 GCAACAGTGCACAGGGAGCATGG - Intronic
921221147 1:212974806-212974828 GGCACAGTGCACAGGGGGCTTGG + Intronic
922701827 1:227765791-227765813 GCCACAGGGGACTGAGCACAGGG - Intronic
922960791 1:229644249-229644271 GCCACAGGCCACAGAGCCAATGG + Intronic
923198514 1:231690390-231690412 TTCACAGAGCACAGAGGGCACGG + Intronic
923537380 1:234863497-234863519 GGGACAGGGCACAGAGGGCAAGG - Intergenic
1062961374 10:1575930-1575952 GCTGCAGAGCACAAAGCGCATGG + Intronic
1063593532 10:7412744-7412766 CCCACAGGGCAGAGAGCCCAGGG - Intergenic
1065377904 10:25061382-25061404 GTAACAGTGCACAGATGGCAAGG + Intronic
1066559550 10:36654295-36654317 GCCACAGTGGGCAGATCACAAGG - Intergenic
1066643431 10:37580081-37580103 GCCCCAGGGAAGAGAGCGCATGG - Intergenic
1067200987 10:44171942-44171964 GCCACAATGCAGGCAGCGCAAGG + Intergenic
1067777276 10:49172703-49172725 GCCTCATTGCACACAGAGCATGG + Intronic
1067777861 10:49176105-49176127 GCCCCATTGCACACAGAGCATGG + Intronic
1069968990 10:72149202-72149224 GCCAAGGTGGACAGAGCACAAGG + Intronic
1070397297 10:76022564-76022586 GCCTCAGGGCCCAGAGTGCAAGG + Intronic
1070828171 10:79403363-79403385 ACCACAGAGCACAGAGGGGAAGG - Intronic
1070925945 10:80221661-80221683 TCCACTGTGCACAGTGCGCCAGG - Intergenic
1073072152 10:100801506-100801528 GCCACAGTGGACAGAGCACCTGG + Intronic
1073476828 10:103759193-103759215 GCCACAGTGCAGAGGGTGCTGGG - Intronic
1075173227 10:120134970-120134992 GCCAGAGTGCCCAGAGTGTAGGG - Intergenic
1075554863 10:123423052-123423074 GCCAAAGTGCACAAAGAACAGGG + Intergenic
1076807404 10:132865962-132865984 TCCACTGTGCACAGTGCGCTGGG + Intronic
1077100553 11:820439-820461 GCCACAGGGCACCGTGTGCAAGG - Intronic
1077578878 11:3404435-3404457 GCCACAGCCCCCAGAGCACATGG - Intergenic
1077578892 11:3404484-3404506 GCCACAGCCCCCAGAGCACATGG - Intergenic
1077825974 11:5808646-5808668 GCCAGAGTGGACAAAGCGAAAGG - Intronic
1079332403 11:19544697-19544719 GACACAGTGCACAGAAAGCATGG + Intronic
1084235914 11:67788003-67788025 GCCACAGCCCCCAGAGCACATGG - Intergenic
1087816360 11:102663220-102663242 CCTACGGTGCACAGAGAGCATGG + Intergenic
1089763496 11:120746213-120746235 ACCACAGTGCTCAGAGCCCTGGG + Intronic
1090197349 11:124827969-124827991 GGCACAGTGAACAAAGTGCACGG + Intergenic
1090450450 11:126801544-126801566 GATGCAGTGCAAAGAGCGCATGG + Intronic
1090670716 11:128943272-128943294 GCCAAAGTGCTGAGGGCGCAGGG + Intronic
1090731747 11:129578525-129578547 GCAAGAGTGCACTGAGCCCACGG + Intergenic
1092406805 12:8227316-8227338 GCCACAGCCCCCAGAGCACACGG - Intronic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1100560375 12:95742732-95742754 GACTCAGTGCTCAGAGGGCAGGG + Intronic
1100715955 12:97305862-97305884 GCCACAACGCACAGAGCATATGG - Intergenic
1102300801 12:111769752-111769774 GCCACACTGCAAACAGCCCAGGG - Intronic
1104415405 12:128593582-128593604 GCCCCAGTGCACAGAGCTGCTGG - Intronic
1104656050 12:130574774-130574796 GCCACAGTGCCTAGAGCACAAGG - Intronic
1104656644 12:130578569-130578591 CCCACAGTGCACAGGCCCCAAGG - Intronic
1104714729 12:131008813-131008835 GCCACAGCCCACAGAGGGAAGGG + Intronic
1104959384 12:132480985-132481007 CCCACAGTGCACAGGGGCCAGGG - Intergenic
1107559635 13:41547575-41547597 ACCACAGTGCACAGGGCAGAGGG - Intergenic
1108453927 13:50594697-50594719 GCCAGAGTTCACAGAGAGCAGGG + Intronic
1109446033 13:62441610-62441632 CCCACAGTGCACAGAGGACAAGG + Intergenic
1110035725 13:70680623-70680645 GCAACAGTGCTCAGAGGCCATGG + Intergenic
1111645318 13:91025148-91025170 GCCTTTGTGCACAGAGCACAAGG - Intergenic
1112504585 13:99968473-99968495 GCCACCGGGGACAGTGCGCAGGG + Intronic
1113711490 13:112468002-112468024 GCCAGACTCCACAGAGAGCAGGG + Intergenic
1114690270 14:24574405-24574427 GCCACAGTGCACAGCGTCCCGGG + Exonic
1117971700 14:61257387-61257409 GTCTCAGTGCACAGTGGGCATGG + Intronic
1119558535 14:75571660-75571682 GCCACACCTCACAGAGCCCATGG - Intergenic
1120051360 14:79870615-79870637 GCCAAAGTGGGCAGATCGCAAGG - Intergenic
1120735248 14:88045393-88045415 GCAAAAGTGCCCAGAGCTCAGGG - Intergenic
1120918029 14:89727335-89727357 GCCACAGTGGCCACAGCCCAGGG - Intergenic
1121661533 14:95638842-95638864 GCCACAGTGGACAGAGCAGAGGG + Intergenic
1122076615 14:99239068-99239090 ACCAGAGTCCACAGAGGGCAAGG + Intronic
1122852441 14:104543989-104544011 GCAAGAGTGCAGAGAGCACATGG - Intronic
1122863607 14:104593653-104593675 GCCAAACTGCACAGAGGGCAGGG + Exonic
1123125127 14:105940855-105940877 TCCACAGAGCACAGTGGGCAAGG + Intergenic
1124087478 15:26564486-26564508 CCAACAGTGCCCAGAGCCCAAGG + Intronic
1126010625 15:44298986-44299008 GACACATTGCAGAGACCGCATGG + Intronic
1126649315 15:50905892-50905914 GCCAAGGTGCACAGACCACAAGG - Intergenic
1127117536 15:55742997-55743019 GCCGCAGAGCAGAGAGCGCCCGG - Intronic
1127286598 15:57538744-57538766 GGCAGAGTGCAGAGAGCGCATGG - Intronic
1127606498 15:60592422-60592444 GCCGCGGTGCGGAGAGCGCAGGG + Intronic
1128173149 15:65530608-65530630 GCCACACTGCCCAGGGCGCGGGG - Exonic
1129510096 15:76115461-76115483 GCCAGAGAGCAGAGAGCGTAGGG - Intronic
1130553595 15:84907767-84907789 TCCACCCTGCACAGAGCACAGGG - Intronic
1130875825 15:88013343-88013365 TCCACTGTGCACAGAGCTCTGGG - Intronic
1133423422 16:5666352-5666374 AGCACAGTGAACAGAGCTCACGG + Intergenic
1135026394 16:19002521-19002543 GCCACAGTGCCCAGCCCGGATGG + Intronic
1136019727 16:27432415-27432437 GCCACAGGGCAGAGAGCCCCAGG - Intronic
1139581385 16:67875945-67875967 GCCCCAGTGCAGAGAGCCCACGG + Exonic
1139921924 16:70466083-70466105 GCCTCAGTGCACAGAGCCCAAGG - Intronic
1140200160 16:72888531-72888553 GCCACAGTGCCCTGTGCCCAGGG + Intronic
1140333503 16:74081142-74081164 GCCACAGTGCTGAGAGTCCAGGG + Intergenic
1141282308 16:82639801-82639823 GCCACAGAGCAGCGAGAGCATGG + Intronic
1141333068 16:83129691-83129713 GCGTCAGTGCACAGAGTGCAGGG - Intronic
1141421358 16:83919599-83919621 CACACAGTGCACAGAACACACGG + Exonic
1141421366 16:83919681-83919703 CACACAGTGCACAGAACACACGG + Exonic
1141421370 16:83919732-83919754 CACACAGTGCACAGAACACACGG + Exonic
1142255130 16:89010229-89010251 GCCACAGTGGACAGTGGGGAGGG + Intergenic
1142919203 17:3169792-3169814 GCCACAGTGCCCAGGGCACTGGG + Intergenic
1144494027 17:15735922-15735944 ACCACAGTGCTGAGAGCCCACGG - Intronic
1144867264 17:18344736-18344758 TCCACAGTGCACAGAGGATAAGG + Intronic
1144906233 17:18640757-18640779 ACCACAGTGCTGAGAGCCCACGG + Intronic
1145773171 17:27508095-27508117 GCCACAGTGAACACTGCCCAGGG - Intronic
1146942311 17:36851814-36851836 GCCATAGGGCCCAGAGAGCATGG - Intergenic
1150752151 17:67874169-67874191 ACCACAGTGTACAGAACACACGG - Intronic
1151577423 17:74959768-74959790 GCCCCAGCCCACAGAGAGCATGG + Intronic
1152133625 17:78491722-78491744 GCCACAGAGAACGGAGGGCAGGG - Intronic
1152234433 17:79131197-79131219 CACACAGTGCACAGAACACACGG - Intronic
1152416720 17:80167462-80167484 GCCACGGGGCACAGAGCCCCTGG + Intergenic
1152716163 17:81901869-81901891 GCCACACTGCACAGTGCCCCGGG - Intronic
1154093275 18:11384964-11384986 CTCACAGTGCACAGAGTGAAAGG + Intergenic
1155013139 18:21803045-21803067 GCCACAGTGTAAAGAGCACAGGG - Intronic
1160383641 18:78479715-78479737 GGCACAGTGGGCAGAGGGCACGG - Intergenic
1160934061 19:1584888-1584910 GCCACAGGGTGCAGAGCGCAAGG - Intronic
1161039703 19:2103675-2103697 GCCACAGTCCCCAGAAGGCAGGG + Intronic
1161561419 19:4974873-4974895 GCCACAGATGACAGAGCGAAGGG - Intronic
1161572355 19:5037511-5037533 GCCACAGTGCAAAAGGCGCCTGG - Intronic
1162041308 19:7972489-7972511 TCTAAAGTGCACAGAGCACATGG - Intronic
1163148873 19:15399645-15399667 GGCCCACTGCACAGAGAGCATGG - Intronic
1164303481 19:23982526-23982548 GACACAGTGCACAGAAGGGACGG - Intergenic
1164572213 19:29382676-29382698 GCCCCAGGTCACAGAGGGCAAGG - Intergenic
1165882269 19:39052653-39052675 GCCACAGTGCTCTCAGGGCAGGG - Intergenic
1166437608 19:42782001-42782023 GCTACAGTTCAAAGAGAGCATGG - Intronic
1166456561 19:42945799-42945821 GCTACAGTTCAAAGAGAGCATGG - Intronic
1167194135 19:48015367-48015389 GCCACTGTGCCCAGTGGGCATGG - Intronic
1168059704 19:53883899-53883921 GACACAGAGCACAGAGCTCAGGG - Intronic
1168136415 19:54355306-54355328 CCCACAGTCCACAAAGCCCATGG - Exonic
1168155113 19:54469638-54469660 GGCACAGTGCCCAGCGCACAGGG + Intronic
1168703723 19:58456299-58456321 GCCACAGTCCACGCAGCGGAAGG - Exonic
1168706231 19:58471847-58471869 GCCACAGTCCACGCAGCGGAAGG - Exonic
926783514 2:16497883-16497905 ACCACAGTGCTCAGATTGCAGGG - Intergenic
926942907 2:18156651-18156673 GCCACAGTGGACACAGTGAATGG - Intronic
929454290 2:42055166-42055188 GCCCCAGTGAACAGAGGGCGGGG - Intronic
932493352 2:72134838-72134860 GCTGCAGTGCACACAGGGCAAGG - Exonic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
934602800 2:95671034-95671056 GCCACAATCCACAGACCTCACGG + Intergenic
936536181 2:113313228-113313250 GCCACAATCCACAGACCTCATGG + Intergenic
936637352 2:114273812-114273834 GCCACAGGGCACAGAGAGTGAGG + Intergenic
937428390 2:121818143-121818165 GGCACAGAGCACAGGGCACAGGG - Intergenic
937428392 2:121818150-121818172 GGCAGAGGGCACAGAGCACAGGG - Intergenic
937707943 2:124942863-124942885 CCCAAAGTGGACAGAGGGCAGGG - Intergenic
939766952 2:146262689-146262711 GCCACAGAACACAGAGTGCCAGG + Intergenic
940069181 2:149665828-149665850 GCCACAGAGCACAGACCAGAGGG - Intergenic
942657901 2:178233344-178233366 GCCACAGTTTTCAGAGAGCAAGG - Intronic
947723324 2:232381936-232381958 GGCTCAGTCCCCAGAGCGCACGG - Exonic
948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG + Intergenic
948455849 2:238104302-238104324 GCCACAGGGCACAGGGCAGAGGG + Intronic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
1168875752 20:1171216-1171238 GCCACAGTGCCCAGAGCACCTGG + Intronic
1169855228 20:10094665-10094687 GCCACATTGCCCAGAGTGGAGGG - Intergenic
1170018604 20:11810963-11810985 GTCTCAGGGCACAGAGCCCAGGG + Intergenic
1170121444 20:12916838-12916860 GCCACAGTTCACAGGGCCCAGGG - Intergenic
1170574881 20:17654737-17654759 GCCACAGTGGACAGACCTTAGGG - Intronic
1170927822 20:20741861-20741883 GACACAGTGCCCAGAGTGCCGGG - Intergenic
1171536467 20:25896959-25896981 GCCAAAGTGGACAGATCACAAGG - Intergenic
1171804640 20:29664199-29664221 GCCAAAGTGGACAGATCACAAGG + Intergenic
1172845406 20:37927400-37927422 GCCACACTGCAAGGCGCGCATGG - Intronic
1174083795 20:47990273-47990295 GGCTCAGTGCACAGGGAGCATGG + Intergenic
1175970638 20:62685066-62685088 GCCACAGTGCATGGAGTGCATGG + Intronic
1176044943 20:63087656-63087678 GCCACACCACACAGAGGGCAAGG - Intergenic
1176210783 20:63920299-63920321 GACACAGAGCACAGAGTGCCGGG - Intronic
1179955250 21:44734853-44734875 GCCAGAGTCCACAGGGCACATGG - Intergenic
1180007968 21:45032038-45032060 GCCACTGTGCACACAGCTCTGGG + Intergenic
1180597971 22:16991659-16991681 GGCAAAGTGCAGAGAGCTCAGGG + Intronic
1180695731 22:17750365-17750387 GCCCCAGGGCACTGAGCGCCTGG - Intronic
1180825047 22:18856059-18856081 GCCACAGTGCAGAGGGAGGAGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181004161 22:20001986-20002008 GCCACAGAAGACAGAGCCCAGGG + Intronic
1181130380 22:20727864-20727886 CCTACAGTGCACAGAGGGTATGG + Exonic
1181187683 22:21118489-21118511 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1181211515 22:21292004-21292026 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
1181500736 22:23314253-23314275 GCCACAGTGCAGAGAGAGGAGGG - Intronic
1181705962 22:24649564-24649586 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1182377005 22:29856045-29856067 GGCAGAGGGCACAGAGCCCAGGG - Intergenic
1182521470 22:30887102-30887124 GCCACAGTTCACAGATGCCATGG - Intronic
1183235118 22:36611089-36611111 TCCACAATGCACAGAGGGCTTGG + Intronic
1183924788 22:41197882-41197904 CCCACAGTGCGCAGAGCACAGGG + Intergenic
1184172915 22:42769900-42769922 GCCTCAGGGCACAGGGCACAGGG + Intergenic
1184682447 22:46079566-46079588 GCCACGGTGGACAGGGCGCCAGG - Intronic
1185125845 22:49010416-49010438 GCCTCAGTGCACTGTGCACAGGG + Intergenic
1185293354 22:50040048-50040070 GCCAGTGTGGACAGAGCTCACGG + Intronic
1203215434 22_KI270731v1_random:3427-3449 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1203275192 22_KI270734v1_random:81964-81986 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
949500865 3:4678900-4678922 GCCACACTGCACAGAGCTTTGGG + Intronic
955856385 3:63278136-63278158 GCCAGAGGGCACCGGGCGCACGG + Exonic
957051866 3:75417752-75417774 GCCACAGCCCCCAGAGCACATGG - Intergenic
961642265 3:128371908-128371930 GCCACTGGGCCCAGAGCTCAGGG - Intronic
961830925 3:129622696-129622718 GCCACAGTGCACAGGGCTCTAGG + Intergenic
961885474 3:130093984-130094006 GCCACAGCCCCCAGAGCACATGG - Intronic
969096719 4:4738156-4738178 GCCACACTGCAAAGTGAGCATGG - Intergenic
969437922 4:7199309-7199331 GGCACAGTGCAGGGAGAGCAAGG + Intronic
970436788 4:16043552-16043574 GCCACAGTCCTCCAAGCGCAAGG + Intronic
972290643 4:37686816-37686838 GCCACGGTGGGCAGGGCGCAAGG - Intergenic
977266795 4:94865239-94865261 GCCAAAGTGGGCAGACCGCAAGG - Intronic
981986882 4:150868246-150868268 TCCCCAGTGCCCAGAGAGCATGG - Exonic
985642042 5:1068045-1068067 GCCACACAGAACAGAGCACAAGG + Intronic
985774306 5:1832830-1832852 GCCACAGAGCCCACAGGGCATGG + Intergenic
986296489 5:6443580-6443602 GCCACAGTGCACAGGCTGCTGGG - Intergenic
987331625 5:16862253-16862275 TCCACAGTGCACTGAGGGCAGGG - Intronic
989172560 5:38487158-38487180 GCCACAGGGGAGAGAGAGCAGGG - Intronic
989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG + Exonic
995648979 5:114346066-114346088 GCCACAGTGCTCAGCCCTCAGGG + Intergenic
996407948 5:123125200-123125222 GCCACAGTGCATAGATCCCAGGG + Intronic
996709671 5:126531944-126531966 GCCACAGTGGAGAGAGCCCTGGG + Intergenic
997580196 5:135012205-135012227 GGCACCTTGCACAGAGCCCAGGG + Intergenic
998269251 5:140691715-140691737 GCCCCGGTGCACGAAGCGCAGGG - Exonic
998399941 5:141843411-141843433 GCCACAGTGAGTAGAGTGCAGGG - Intergenic
1000719680 5:164691710-164691732 GCCACAGTTGACAGAGCCAAGGG + Intergenic
1000814002 5:165898339-165898361 GCCACAGTGCCCAGCCCGTAAGG - Intergenic
1001777352 5:174338530-174338552 GCCTCAGGGCACTGAGAGCAGGG - Intergenic
1002432520 5:179211746-179211768 GCCACAGTGCACAGGGCACGTGG + Intronic
1004167172 6:13266977-13266999 GACACTGTGCCCAGAGCTCAGGG - Exonic
1012049888 6:94328363-94328385 GCCACAGAGGACAGAGCACCTGG + Intergenic
1013564246 6:111341622-111341644 GCCACAGTCTACACAGAGCAAGG + Intronic
1014486473 6:122005104-122005126 GCCACAGTGCACACAGATTATGG - Intergenic
1017219437 6:151949193-151949215 GCTAAAGTCCTCAGAGCGCATGG - Intronic
1018473118 6:164113755-164113777 GCCAAAATGCACAGAGGGGAGGG - Intergenic
1018911100 6:168101291-168101313 ACCCCAGGGCCCAGAGCGCAGGG - Intergenic
1019210669 6:170402010-170402032 CCCACAGAGCCCAGGGCGCAGGG - Intronic
1019612971 7:1946165-1946187 GCCAGAATGCACAGAGGGCAGGG - Intronic
1019910967 7:4100407-4100429 GCCAGAATGCAGAGAGCACAGGG + Intronic
1022505045 7:30904416-30904438 GCCACAGTGTACATGGCACAGGG + Intergenic
1022809048 7:33850992-33851014 GCCAGAGTGCTCAGAGAACAAGG + Intergenic
1023605392 7:41926662-41926684 GCCACAGTGGACAGAGTGTTAGG + Intergenic
1023844825 7:44114663-44114685 GCCAGAGTGCCCAGGGCTCAAGG + Intronic
1026523140 7:71133109-71133131 GGCACAGGGCGCAGCGCGCAAGG - Intronic
1027724283 7:81784163-81784185 GCCAAAGTGAACAGAACTCAGGG - Intergenic
1032496166 7:132364411-132364433 GCCCCAGTGCAGAGAGGACAAGG - Intronic
1034895733 7:154875345-154875367 GCCACACTGCCCAGAGCCAATGG + Intronic
1034992268 7:155555348-155555370 GCCACGATGCTCAGAGCGCCGGG + Intergenic
1035024709 7:155818033-155818055 GGCACAGGGCACAGGGCACAGGG - Intergenic
1035370825 7:158377859-158377881 CCCACAGTCCACACAGCACAGGG + Intronic
1035492745 7:159294559-159294581 GCCCCAGGGCTCAGAGCCCAAGG + Intergenic
1036847181 8:12178295-12178317 GCCACAGCCCCCAGAGCACATGG - Intergenic
1036868548 8:12420616-12420638 GCCACAGCCCCCAGAGCACATGG - Intergenic
1037150029 8:15626102-15626124 GACACAGGGCACAGGGGGCACGG - Intronic
1037779916 8:21860900-21860922 GACACAGTGCGCAGAGAGCATGG + Intergenic
1048493107 8:134912909-134912931 GCCACAGAACACAGAGCTCAAGG + Intergenic
1049749764 8:144277600-144277622 GCCACGGGGCACAGAGCGCTGGG - Intronic
1050471310 9:5993803-5993825 GGCACAGAGCACAGTGCACAAGG + Intronic
1053132229 9:35622552-35622574 GCCAAGGTGCACAGATCACAAGG + Intronic
1056896427 9:90554899-90554921 GCCTCAGTGCCCAAAGCACAGGG - Intergenic
1057487853 9:95499976-95499998 GCCCGAGTGGACAGAGCCCAGGG + Intronic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1061533765 9:131235031-131235053 TCCTAACTGCACAGAGCGCAGGG - Intergenic
1061796893 9:133090866-133090888 GCCACAGTGTGCAGGGCACAGGG + Intergenic
1186575523 X:10761463-10761485 GCCACAGTACACTGTGGGCAGGG + Intronic
1195698317 X:107683120-107683142 GCCACACTGCACACAGCCCCTGG + Intergenic
1198167682 X:134073405-134073427 CCTACAGTGCACAGAGAGCATGG - Intergenic
1200774079 Y:7153952-7153974 GCCACAGTGCCCAGCCTGCATGG + Intergenic
1201479685 Y:14426512-14426534 GCCATGGTGCAGAGAGCCCAAGG + Intergenic