ID: 1061422944

View in Genome Browser
Species Human (GRCh38)
Location 9:130481994-130482016
Sequence CCCTCCCAGCTCTCCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 427}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061422944_1061422957 28 Left 1061422944 9:130481994-130482016 CCCTCCAGGGAGAGCTGGGAGGG 0: 1
1: 0
2: 5
3: 50
4: 427
Right 1061422957 9:130482045-130482067 ATTTACAGATGCGGAAGCCAGGG No data
1061422944_1061422952 19 Left 1061422944 9:130481994-130482016 CCCTCCAGGGAGAGCTGGGAGGG 0: 1
1: 0
2: 5
3: 50
4: 427
Right 1061422952 9:130482036-130482058 CAGCACCCCATTTACAGATGCGG No data
1061422944_1061422956 27 Left 1061422944 9:130481994-130482016 CCCTCCAGGGAGAGCTGGGAGGG 0: 1
1: 0
2: 5
3: 50
4: 427
Right 1061422956 9:130482044-130482066 CATTTACAGATGCGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061422944 Original CRISPR CCCTCCCAGCTCTCCCTGGA GGG (reversed) Intronic
900160372 1:1220421-1220443 ACCTCCCACCCCTCCCTGCATGG - Intronic
901459089 1:9380967-9380989 CCCTACCAGCTCTCCGTGGCAGG + Intergenic
901636704 1:10673893-10673915 CCCTCCTTGCCCTCTCTGGATGG + Intronic
901664736 1:10819806-10819828 CCCTCCCAGTGCCCCCTGGAAGG - Intergenic
901719976 1:11189252-11189274 CCCTCCCAGCTCATCTGGGAGGG - Intronic
902338430 1:15767320-15767342 CCCTCCCAGGTCCACCTGGGAGG + Intronic
902628631 1:17691412-17691434 TCCTCCCAGCCCCCACTGGACGG - Intronic
903500857 1:23799603-23799625 TCCTCCCAGCTGACCCTTGAGGG - Intronic
904251087 1:29224869-29224891 CCCTCCCACCTCACCCAGGGTGG + Intronic
904425163 1:30418134-30418156 CCAACCCAGCTCTGCCTGGCTGG - Intergenic
904470590 1:30733714-30733736 CCCTCCCGCCCCTCCCTGGCAGG - Exonic
904593491 1:31628356-31628378 CCAGCCCAGCTCTCTGTGGACGG + Intronic
904659790 1:32075805-32075827 CCCTCCCACACCTCCCTGGTAGG + Exonic
905210303 1:36369550-36369572 CCCGCCCAACTCTCCCTGGTTGG + Intronic
905772767 1:40649016-40649038 CCCGCCCACCTCTCCCTGAGTGG - Intronic
905881501 1:41467202-41467224 GCCTCCCTGCACTCCCTGGAAGG + Intergenic
906078773 1:43070057-43070079 CCCTCCCACCACTCCCCAGATGG + Intergenic
906106132 1:43293769-43293791 CCCTCCCAGCCCTGCCTGCCTGG + Intergenic
906157225 1:43620820-43620842 CCCACCCACCTTTCCCAGGATGG + Exonic
906296231 1:44650683-44650705 CCCTCCCTGTTCTCCCTGCAGGG + Exonic
906731378 1:48084367-48084389 CCCTCCCAACAATCCCTGGGAGG - Intergenic
910037099 1:82801548-82801570 CCCTCCCTTCTCTCCCAGAATGG - Intergenic
912953377 1:114135800-114135822 CCCTCACCCCTCTCCCTGGGTGG + Intronic
913247089 1:116879367-116879389 CTCTCCCCTCTCTCCCAGGAGGG - Intergenic
915361390 1:155288200-155288222 CGCTCCCAGGTCTCCCTGCTGGG + Exonic
916184518 1:162117766-162117788 CCCTTCCAGCTCTTTCAGGAAGG + Intronic
918048231 1:180954017-180954039 CCCCCCCAAGTCTCCCTGGCAGG + Intergenic
918306458 1:183251173-183251195 CCCTCCCAGATCTCCCTTCTGGG + Exonic
919132368 1:193467235-193467257 TGTTCCCAGCTCACCCTGGAGGG - Intergenic
919814249 1:201427877-201427899 CCCACCCAGGCCTTCCTGGAGGG - Intronic
920231987 1:204476697-204476719 CCCAGCCATCTCTCCCTGGATGG - Intronic
921681991 1:218044589-218044611 CACCCCCAACTCACCCTGGATGG - Intergenic
922776536 1:228216681-228216703 GCCTACCAGCTCTCCGTGCAAGG + Exonic
922787931 1:228292514-228292536 CCTTCCCAGCTCTGCCTGCCAGG + Exonic
923558950 1:235023768-235023790 CCCTCCCACCCCTCCCCCGAAGG - Intergenic
923653193 1:235892747-235892769 CCCTCCCCACCCTCCCTGGTGGG - Intergenic
923954354 1:238997929-238997951 CCCTCCCACCTCTCCCCCCAAGG + Intergenic
924427145 1:243962335-243962357 ACCTCTCTGCTATCCCTGGAGGG + Intergenic
1062860886 10:808194-808216 CCCTGCCAGAACTCCCTGGATGG - Exonic
1064938044 10:20702263-20702285 CCCTGCAAACTGTCCCTGGAGGG + Intergenic
1065917905 10:30367764-30367786 ACCTCCCAGCCCTTCTTGGATGG + Intronic
1066661356 10:37740522-37740544 CCCTCACAGTTCTGCCTAGAAGG - Intergenic
1066755909 10:38713096-38713118 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1067090702 10:43264664-43264686 CCCTCCCTGCTGCCCCTTGACGG - Intronic
1067338836 10:45384790-45384812 CCCCCCCATCTCTCAATGGAAGG + Intronic
1067762320 10:49057609-49057631 CACTCCCACCCCTGCCTGGAGGG + Intronic
1068601820 10:58964753-58964775 CCCTCCCCTCTCTACCTGAAAGG - Intergenic
1068661427 10:59627140-59627162 CCATCCCACCACTCCCAGGATGG + Intergenic
1069630591 10:69894969-69894991 CCCTCCCAGCTGTCACTCCATGG + Intronic
1070813349 10:79309367-79309389 CCCTCCCTGCTCTCCCAGGGTGG + Intronic
1072721577 10:97784285-97784307 CCCTACCAACCCACCCTGGAGGG + Intergenic
1072801962 10:98398359-98398381 CCCACCCTCCTTTCCCTGGAGGG + Intronic
1072806927 10:98429695-98429717 CTGTCCCTGCTCTCCCAGGAGGG + Intronic
1073147203 10:101288656-101288678 CTCTGCCCCCTCTCCCTGGAGGG - Intergenic
1073326706 10:102647513-102647535 CCCTGCCTGCCCTCCCAGGAGGG + Intronic
1073441630 10:103555782-103555804 CCTACCCACCTCTCCCGGGACGG + Intronic
1074522725 10:114239825-114239847 CCCCGCCAGCTCGCCCGGGACGG - Intronic
1075463349 10:122633016-122633038 CCCTGCCAGCCCTCAGTGGACGG + Intronic
1075915150 10:126160527-126160549 CCTTCCCAGCTCTCCCTTCCAGG + Intronic
1076402563 10:130193554-130193576 CCCACCCAGCTCTCCCGGGTCGG + Intergenic
1076701982 10:132278019-132278041 CACCCCCACCTCTCCCTGGAGGG - Intronic
1076761575 10:132608523-132608545 CCCTCGCAGGTCTTCATGGAAGG + Intronic
1077006167 11:358288-358310 CCCACCCCGCGCTCTCTGGAAGG - Intergenic
1077407003 11:2387137-2387159 CACCCCCAGCCCTCCCTGGCTGG - Intronic
1077638548 11:3860550-3860572 CTCCCCCAGCTCTCCCAGGCAGG - Intronic
1078892115 11:15566847-15566869 TCCTCACAACACTCCCTGGAAGG + Intergenic
1079243452 11:18736850-18736872 CGATCCCAGCCCTACCTGGAGGG - Intronic
1080404385 11:31965858-31965880 CTCCCCCAACTCCCCCTGGAGGG - Intronic
1080424540 11:32143975-32143997 CCATCTCTGCTCTCCCTGGGAGG - Intergenic
1083264728 11:61541430-61541452 CACCCCCTGCTCTCCCTGGAGGG - Intronic
1083770617 11:64864881-64864903 CACTCCCCCCTCCCCCTGGATGG + Intronic
1083821011 11:65171398-65171420 GCCCCCCAGCTCTACCTGGGTGG - Exonic
1084540377 11:69782607-69782629 CCCCCCTCCCTCTCCCTGGATGG + Intergenic
1084913758 11:72412069-72412091 CCCTCCCAGCCCTGGCTGGCAGG - Intronic
1085470348 11:76753575-76753597 CCCTCCCTGCTCCTCCTGGTCGG - Intergenic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1088279983 11:108125966-108125988 TCTTCCCAGCTCTCCATGGCTGG - Intronic
1088625764 11:111729308-111729330 CCATCACAGCTCTCCCTGGGTGG - Exonic
1089138879 11:116270777-116270799 CCTGCCCAGCTCTGCCAGGAGGG - Intergenic
1089627275 11:119759447-119759469 CCGACCCAGCTCCCTCTGGATGG + Intergenic
1089764848 11:120755792-120755814 CCACCCCAACTCTCCCTGGAGGG - Intronic
1089950514 11:122521263-122521285 CTCTCCCTGCTCTCACTGTAAGG - Intergenic
1090241917 11:125189854-125189876 ACATCCCTGCTTTCCCTGGATGG + Intronic
1090359170 11:126160795-126160817 CCGTCCCTGCTCTCCCAGGCTGG - Intergenic
1092163028 12:6326527-6326549 CCCTCCACGCCTTCCCTGGAGGG + Exonic
1092281611 12:7101867-7101889 CCCTCCCTGCACCCCCAGGAGGG + Intronic
1092288389 12:7143181-7143203 CAGTCCCTGCTCACCCTGGAGGG + Exonic
1094831688 12:34303224-34303246 CCTTCCCAGCAGTCCCTGCACGG + Intergenic
1094833660 12:34312262-34312284 CCTTCCCAGCAGTCCCTGCACGG - Intergenic
1094834193 12:34314587-34314609 CCTTCCCAGCACCCCCTGGGTGG - Intergenic
1095802190 12:46281073-46281095 CCCTCCCAAGTCTGCCTAGAAGG + Intergenic
1095943361 12:47740238-47740260 CCCATCCAGCACTCCCAGGAGGG + Intronic
1096565278 12:52473111-52473133 CCCTCCTAGGTCTCCCTAGCAGG + Intronic
1096567298 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG + Intronic
1096694019 12:53337528-53337550 CCCTCCCAGCTCTCCCTGTCAGG + Intronic
1097175905 12:57142851-57142873 CCATCCCAACTCTTCCTGGCAGG + Intronic
1100981467 12:100165937-100165959 GCCTTCCAGCTCTTCTTGGATGG + Intergenic
1101413193 12:104486074-104486096 CCCTCCCAGCCTTCCCTGCCTGG + Intronic
1102077688 12:110073163-110073185 CCTGCCCTGCTCTCCCTGGCGGG + Intronic
1102198372 12:111040509-111040531 CCCTCCCATCTCTCTGTGGTTGG + Intronic
1102220920 12:111193866-111193888 CCATCCCAGCTGGCCCTAGAGGG - Intronic
1102981788 12:117247432-117247454 CCCTCCCAGTTCTTCCAGGAGGG + Exonic
1103565624 12:121814085-121814107 CTCTCCCTGCTCTCTCTGCAGGG + Exonic
1103783082 12:123412529-123412551 CACTACCAGCTCTTCCTGGAAGG + Exonic
1104364375 12:128163745-128163767 CCCTGCCAGGGCTCCTTGGATGG + Intergenic
1104953457 12:132452835-132452857 CCCTCCCAGCTCTGACTGCCAGG + Intergenic
1105915265 13:24909565-24909587 CCCTGCCAGCTCTTTCTGTATGG - Intronic
1106034790 13:26033787-26033809 CACTCCCACTTCTCCATGGAAGG + Intergenic
1106465606 13:30011767-30011789 CTCTTCCAGCTCTTCGTGGAGGG + Intergenic
1106581872 13:31025905-31025927 CCCTCCCAGCTCTCCCCATTTGG - Intergenic
1107938528 13:45364878-45364900 CTCTCAGTGCTCTCCCTGGAAGG - Intergenic
1108524324 13:51272850-51272872 GCCTCCCAGTTCTCCCGAGAGGG - Intronic
1112065038 13:95783932-95783954 CCCTCCCTCCTCTTCCTGGATGG - Intronic
1113513202 13:110872153-110872175 CCCTCCCGCCTCTCCCTGCGGGG + Intergenic
1113782495 13:112984778-112984800 CCCTTCCAGCTTTCCTTCGAGGG - Intronic
1113802708 13:113094797-113094819 TCCTCCTAACTCTCTCTGGAAGG + Intronic
1113802724 13:113094856-113094878 TCCTCCTAACTCTCTCTGGAAGG + Intronic
1115257024 14:31414118-31414140 TTCTCCCATCTCTCCATGGAAGG + Intronic
1117792111 14:59351973-59351995 CTCACCCAGCTCTGCATGGAAGG + Intronic
1118600638 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG + Intronic
1118735820 14:68701285-68701307 CCCTGTCACCTCTGCCTGGAAGG + Intronic
1118778075 14:68986291-68986313 AGCTCCCAGCCCTCCTTGGAGGG - Intergenic
1119530240 14:75354973-75354995 CCCCCCCAGCTCCTCCTGCAGGG + Intergenic
1120980656 14:90286242-90286264 GCCTCCCAGCTCTCCTGGGCAGG + Intronic
1121472309 14:94165236-94165258 CCCCCTCAGCTGTCTCTGGAAGG - Intronic
1122585610 14:102804080-102804102 CCCTCACATCTCAGCCTGGAAGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122768924 14:104088554-104088576 CCCTCCCTGCTGTGCCTGCAAGG - Intronic
1122913179 14:104843640-104843662 CCCTTCCTGCTTTCCCTGGCGGG + Intergenic
1123440173 15:20285150-20285172 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1123666161 15:22610706-22610728 GCCTCCCAGCCCTTCTTGGATGG + Intergenic
1124008239 15:25811514-25811536 CCCTCCCGGCTTTCTGTGGATGG + Intronic
1124319984 15:28705112-28705134 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1124482527 15:30090305-30090327 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1124488984 15:30142407-30142429 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1124521047 15:30406904-30406926 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1124537615 15:30559316-30559338 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1124544070 15:30611371-30611393 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1124754546 15:32395916-32395938 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1124761041 15:32448271-32448293 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1124777593 15:32600792-32600814 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1125324639 15:38524477-38524499 TCCTCCCAGCTCTCCCTCCAAGG - Intronic
1125886529 15:43233916-43233938 CCCTCCCCTCTCTACCAGGAAGG + Intronic
1125927302 15:43573337-43573359 CCCTCCCAGCCCTCCCTCACAGG + Exonic
1125940445 15:43672902-43672924 CCCTCCCAGCCCTCCCTCACAGG + Intergenic
1127117352 15:55742249-55742271 CCCTCCCATCTCCTCCTGGCTGG + Intronic
1128218919 15:65953968-65953990 CCACCCCAGCTCTCCCTGCCCGG - Intronic
1128222360 15:65978270-65978292 TGGTCCCAGCTCTCCCTGGGAGG + Intronic
1128547864 15:68579605-68579627 CCCGCCGCGCACTCCCTGGAGGG - Intronic
1129029882 15:72610382-72610404 GCCTCCCAGCCCTTCTTGGATGG - Intergenic
1129038091 15:72663130-72663152 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1129148775 15:73673507-73673529 CTCTCCCAGCTCTGCTTGGAGGG - Intergenic
1129211799 15:74074101-74074123 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1129220701 15:74130148-74130170 CCTTCCCAGCACGCCCTGCAGGG + Intronic
1129258061 15:74345411-74345433 TCCTCCCTGCTCTGCCTGGCTGG + Intronic
1129270288 15:74415971-74415993 CCCACCCTGGTCCCCCTGGAAGG + Exonic
1129332321 15:74834026-74834048 CTGTCCCAGCCCTCCCTGAAAGG - Intergenic
1129398604 15:75266983-75267005 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1129402212 15:75291259-75291281 GCCTCCCAGCCCTTCTTGGATGG - Intronic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1129475756 15:75783716-75783738 ACCTCCCAGCCCTTCTTGGATGG - Intergenic
1129728922 15:77918373-77918395 GCCTCCCAGCCCTTCTTGGATGG + Intergenic
1129839590 15:78735488-78735510 GCCTCCCAGCCCTTCTTGGATGG - Intergenic
1129895472 15:79102544-79102566 CCATCCCAGCTCTCCGTAGCTGG + Intergenic
1130012399 15:80161799-80161821 CCCTCCCTGCTCTCTCTAGCAGG - Intronic
1130886200 15:88094551-88094573 CCTTCTCAGCTGTCTCTGGAGGG - Intronic
1131259133 15:90879576-90879598 CCCTACCAGCACTCTCTGTAGGG + Intronic
1131263906 15:90904419-90904441 CCCTCCCACCCCCCGCTGGAGGG + Intronic
1131426182 15:92347104-92347126 AACTCCCAGCCCTCCCTGGTAGG - Intergenic
1131446600 15:92503260-92503282 CTCTTCCAGATCTCTCTGGAGGG + Intergenic
1131455569 15:92580132-92580154 CCCTCCCACCTCCCGCTGCAAGG + Intergenic
1132233235 15:100200351-100200373 CCCTCCCAGCATTCCCCAGAGGG - Intronic
1132312012 15:100864094-100864116 GCATCCCAGCTCCCCCTGGCTGG - Intergenic
1132330556 15:101009406-101009428 CCCTTCCCACTTTCCCTGGAAGG - Intronic
1132432870 15:101774903-101774925 GCCTCCCAGCCCTTCTTGGATGG + Intergenic
1132701881 16:1225480-1225502 CCTTCCCCGCTTTCCCTTGACGG - Intergenic
1132873981 16:2127901-2127923 CCCTCCCACCTCTCCCTCCCTGG - Intronic
1133207241 16:4240995-4241017 CACTGCCTGCTCTCCCTGCAGGG + Intronic
1133757734 16:8775217-8775239 CCCTCCCAGCTCTCTCTGTAAGG + Intronic
1134553068 16:15147075-15147097 CCCTCCCACCTCTCCCTCCCTGG - Intergenic
1134875863 16:17698010-17698032 CCTCCCCAGTTCTCTCTGGAGGG - Intergenic
1136394237 16:29984203-29984225 CCCTCCCAGCCCCCCTGGGAGGG + Intronic
1136726769 16:32363774-32363796 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1136844999 16:33569286-33569308 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1137721536 16:50630394-50630416 CCCTTCCGGCCCTCCCAGGAAGG - Intronic
1138536343 16:57662397-57662419 CCCCCCCATCTCTCCATGGGGGG - Intronic
1138561190 16:57801995-57802017 CACCCCCAGGGCTCCCTGGAAGG - Intronic
1138900435 16:61262796-61262818 CTCTCCCATCTCTCCCTCCAGGG + Intergenic
1139059386 16:63230519-63230541 CTCTCTCAGCTCTACCTGGTTGG + Intergenic
1139369573 16:66458426-66458448 CCCTCCCCTCCCACCCTGGAGGG + Intronic
1141189650 16:81815249-81815271 GGTTCCCAGCTCTCCCTGGTGGG + Intronic
1141500166 16:84438585-84438607 CCCCTCCAACTCTCCCTGTACGG - Intronic
1141842317 16:86580999-86581021 CCCTCCCAGCCCTGCCAGGCAGG + Exonic
1141878399 16:86841964-86841986 CCCTCCCAGGTCTCTCAGGATGG + Intergenic
1142206913 16:88787670-88787692 CCGCCCCACCTCTCCCTGGCTGG - Intergenic
1142349542 16:89573849-89573871 CCCTCCCAGCTTTCCCTGCAGGG - Intergenic
1142442268 16:90106522-90106544 CCCTCTCAGGTGTCCCTGTAGGG - Intergenic
1202999665 16_KI270728v1_random:153984-154006 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1203106707 16_KI270728v1_random:1417939-1417961 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1203131263 16_KI270728v1_random:1690384-1690406 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1203155167 16_KI270728v1_random:1869584-1869606 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1142597613 17:1037123-1037145 CTCTCCCAGCCCCACCTGGATGG - Intronic
1142997407 17:3769080-3769102 CCTTCCCTGCTCCCCCAGGAAGG + Intronic
1143916945 17:10301321-10301343 TCTTCCAAGCTCTCCCTGGGTGG + Intronic
1144778366 17:17796046-17796068 CCCTTCCATCTGTCCCTGGGGGG - Exonic
1145394856 17:22487086-22487108 CCATCCCACCTTTCCCTTGAAGG - Intergenic
1146944859 17:36866731-36866753 CCCTCCCAGCTCACCCTCCCTGG - Intergenic
1146945422 17:36870036-36870058 CCCTCCCAGCTCACCCTCCCTGG - Intergenic
1147864894 17:43545698-43545720 CCATCGCAGCCCTCCCTGGACGG - Intronic
1147969004 17:44209719-44209741 CTCACTCAGCTCTCTCTGGAGGG + Exonic
1149447684 17:56726226-56726248 TCCTTCTAGCTCTCCTTGGAGGG - Intergenic
1149511322 17:57244017-57244039 GCCTCCCAGTGCTGCCTGGAGGG - Intergenic
1149641274 17:58204475-58204497 CCCTCACATCCTTCCCTGGATGG + Intronic
1149661447 17:58336214-58336236 CCCTTCCCCATCTCCCTGGAGGG + Intergenic
1149919709 17:60645740-60645762 CCCTTCCAGTTTTCCCTGTAAGG - Intronic
1150452501 17:65280482-65280504 CCATCCCAGCTCCACCAGGAAGG - Intergenic
1150512012 17:65764057-65764079 CCCTCCTAGCTCAACCAGGATGG + Intronic
1151594362 17:75068074-75068096 CCCTCCTAGCTCAACCTGGTAGG - Intergenic
1152028384 17:77826478-77826500 CCCTACCAGCTCTCCACAGAGGG - Intergenic
1152073905 17:78147260-78147282 CCCTCACAGCTCTGCCCGGTGGG + Intronic
1152152573 17:78611719-78611741 CCCAGCCAGCTCCCCGTGGAGGG - Intergenic
1152202635 17:78956067-78956089 CCCTCCCAGTTTGCCCAGGATGG + Intergenic
1152271272 17:79326309-79326331 CCCTCCCTTCTCGCCCTGCACGG + Intronic
1152504413 17:80738136-80738158 CCCTCCCAGCACCCACTGGCAGG - Intronic
1152634313 17:81424235-81424257 TCCTCCCAGTGCTGCCTGGAGGG + Intronic
1152844541 17:82591636-82591658 CGCTCCCAAGTCTCCCTGGCAGG + Intronic
1153391414 18:4564612-4564634 CCGTCCAAGCTGTCTCTGGATGG + Intergenic
1153535848 18:6100840-6100862 CCCTCCCAGCTCTGCTAGGGTGG - Intronic
1153804533 18:8700912-8700934 ACCTCCCAGCTCTCTTTGCAAGG - Intergenic
1154060575 18:11056032-11056054 CCCTGCCAGGTATCCCTGCAAGG - Intronic
1155128123 18:22900992-22901014 CCCTGCCAGTGCTGCCTGGATGG - Intronic
1157695867 18:49723124-49723146 CCCTTCCAGGTCTCCCAGCAAGG - Intergenic
1158602601 18:58867568-58867590 CCCCCCTGGCTCTCCCAGGAAGG - Intronic
1160169986 18:76544894-76544916 TCCTCCCAGCTTTTCCAGGAAGG + Intergenic
1160352802 18:78199172-78199194 CCCTCCCATCTCTGCCTCGGTGG + Intergenic
1160824945 19:1075071-1075093 CGCCCCCAGCTCTGCCTGGAAGG + Intronic
1161513782 19:4685404-4685426 CGCTCCCCGCCCTTCCTGGATGG - Intronic
1161641585 19:5426978-5427000 CCCTCCCTGATCTCCCAGGCTGG - Intergenic
1161984490 19:7646228-7646250 CCCTCCCTGCCCTGCCTGTAGGG + Exonic
1162131092 19:8526649-8526671 CCCACCCAACTCTCGCTGGTTGG + Intronic
1162947455 19:14052427-14052449 CAATCCCAGCTCTGCCTGGCTGG - Exonic
1163270696 19:16251721-16251743 CCCTCCTGGATCTCCCAGGAAGG + Intergenic
1164540817 19:29120333-29120355 CCTTCCCAACTCCCCCTGGAGGG + Intergenic
1164630648 19:29759576-29759598 CCCTACCATCCCTCCCTGCATGG - Intergenic
1165269835 19:34696590-34696612 CCCTCACAGCTTCCCCTGGCTGG - Intergenic
1165347629 19:35258851-35258873 CCTTCCCAGCACACCCAGGAGGG - Intronic
1166443710 19:42839739-42839761 CCCTGCCAGGTCTCCATGGCAGG + Intronic
1167033906 19:46981766-46981788 CCCCACCAGCTCTCACCGGAGGG + Intronic
1167116671 19:47492700-47492722 CCCTCGCAGAGCTTCCTGGAGGG - Intronic
1167145780 19:47680306-47680328 CGCCCCCGGCTCGCCCTGGATGG - Exonic
1167311654 19:48740641-48740663 CCCTCCCCGCTCTTCCTGCCGGG - Exonic
1167504501 19:49863949-49863971 CCCTTCCAGCCATACCTGGAAGG + Exonic
1167515377 19:49920544-49920566 CCTTCCCAGCACCCCCTGGTTGG - Intronic
925129420 2:1483803-1483825 CTCTCCCTGGTCTCCCTGAAGGG + Intronic
925587179 2:5475507-5475529 CCCTCCCAGCGCTCCCTCAAGGG - Intergenic
925741575 2:7009683-7009705 CCCTGGCAACTCTCACTGGATGG - Intronic
925882937 2:8368215-8368237 CCCTGCATGCTCTCCTTGGAGGG + Intergenic
926138266 2:10352703-10352725 CCTCCCCAGCTCTCCCTGGGGGG - Intronic
927962543 2:27250045-27250067 CCCTCCAAGCACCCCTTGGAAGG + Intergenic
928296316 2:30087135-30087157 CCCCCCCATCTGTCCCTGGCTGG - Intergenic
929591945 2:43153342-43153364 GCCTCCTAGGTCTCCCTGGCTGG + Intergenic
929666597 2:43838600-43838622 GGCTCCCAGAGCTCCCTGGAGGG - Exonic
930705972 2:54505536-54505558 CTGTGCCAGCTCTCCCAGGAAGG + Intronic
932144615 2:69306809-69306831 CCCTCCCCGCTCTCTCTGCTCGG - Intergenic
932227323 2:70052869-70052891 TGCTCCCAGCTGTCCCTGCAGGG - Intergenic
932400597 2:71478673-71478695 AGCTCCCCCCTCTCCCTGGAGGG + Intronic
932721633 2:74142961-74142983 CCCACCAAGCTCTGCCTCGAGGG - Intronic
934319212 2:91957335-91957357 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
934755920 2:96824796-96824818 CTCTGCCAGCTCTGCCTGGGGGG + Intronic
934943088 2:98516463-98516485 CCTTTCCACCTCTCCCTGCAGGG - Intronic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936064325 2:109319120-109319142 CACTCCCATCTCTGCCTAGATGG + Intronic
937032952 2:118756044-118756066 CCCTGCCAGCCTTCCCTGTAGGG - Intergenic
938119865 2:128625811-128625833 CGTCCCCAGCTCTCCATGGAGGG + Intergenic
938947448 2:136226045-136226067 CCCCCTCAGCACTCCCTGGCAGG + Intergenic
940171807 2:150836641-150836663 TCCTCCCATCTCTACCAGGAAGG + Intergenic
945914023 2:215683495-215683517 CCCTCTCTGCTCTCCCTGACAGG - Intergenic
946427307 2:219606186-219606208 GCCCCTCAGCTCTACCTGGAGGG + Exonic
947575434 2:231270017-231270039 CCCACCCAGATCCCCCTGGGTGG - Intronic
947806265 2:232970457-232970479 CCCTCCCCTCACTCCCTGAAGGG + Intronic
948894194 2:240920705-240920727 ACCTCACAGGTCACCCTGGAAGG - Intronic
1168964668 20:1892196-1892218 CCCTCACCTCTCCCCCTGGAGGG - Intergenic
1170605678 20:17873790-17873812 CACTCCCACCCCTCCCTGGAAGG + Intergenic
1170761022 20:19251763-19251785 GTCTCCCAGCTCCTCCTGGAGGG - Intronic
1171256379 20:23691617-23691639 GACTCCCAGCTGTCCCAGGAAGG - Intergenic
1171263734 20:23753527-23753549 GACTCCCAGCTGTCCCAGGAAGG - Intergenic
1171272773 20:23829210-23829232 GACTCCCAGCTATCCCAGGAAGG - Intergenic
1171431176 20:25083967-25083989 CTCCCCTAGGTCTCCCTGGAAGG + Intergenic
1172028067 20:31962915-31962937 CCCACCCATCTGTCCCTGGGAGG - Intergenic
1172161494 20:32871932-32871954 GACTCCCAGCTCTGTCTGGAAGG + Intronic
1172178838 20:32988399-32988421 TCCTCCCAGCTGTCCCTGAATGG + Intronic
1172376654 20:34447597-34447619 CCCCACTGGCTCTCCCTGGACGG - Intronic
1172398084 20:34624023-34624045 ACCTCCCAGGTCTCCCTATAAGG + Intronic
1172427098 20:34862952-34862974 CCCTCCCAGATCTTCCAGCAGGG - Exonic
1173553062 20:43946769-43946791 CCATCCCAGCTGTGCCTGGGAGG + Intronic
1174090321 20:48041778-48041800 CCCTCCATGCTTACCCTGGAAGG - Intergenic
1174419653 20:50391252-50391274 CCTTCCCCTCTCTCCCTGGTAGG + Intergenic
1174991521 20:55515760-55515782 CCCTGACATCCCTCCCTGGAAGG - Intergenic
1175282144 20:57811075-57811097 TCCTACCAGCTCACCCTGCAGGG - Intergenic
1175285022 20:57832076-57832098 CCCACACAGCTCACCCTCGATGG + Intergenic
1175935973 20:62514212-62514234 CCCTGCCTCCTCTCCCTGGCGGG - Intergenic
1175998492 20:62821749-62821771 CACTCCTGCCTCTCCCTGGAGGG - Exonic
1176018548 20:62951313-62951335 CCCACCCAGCCATCCCTGCATGG + Intergenic
1176049814 20:63112811-63112833 CCCTCCCAGCCTTCCCTTCAAGG - Intergenic
1176092401 20:63325089-63325111 CCCTCACTGCTCACCCTGGGAGG - Intronic
1176269715 20:64229892-64229914 CCCTGCCCACTGTCCCTGGAGGG + Intronic
1179126947 21:38599187-38599209 CCCTCTCACCTCACCATGGATGG - Intronic
1179566402 21:42251744-42251766 GTCTCCCAGCTCTCTCTGGGTGG - Intronic
1179790909 21:43755503-43755525 CCCTCCGGGCTCTCCGTGGTGGG + Intronic
1180307391 22:11140981-11141003 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1180545911 22:16503204-16503226 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1180704051 22:17797940-17797962 GGCTCCCAGCTCCCCCTGGTTGG + Intronic
1182170488 22:28224011-28224033 CATTCCCAGATGTCCCTGGAGGG - Intronic
1182277034 22:29196150-29196172 CCCTCCGTGCTCTCCCAGGAGGG - Intergenic
1182365456 22:29775837-29775859 CCGCCCCAGAGCTCCCTGGATGG + Intergenic
1182657555 22:31902768-31902790 CCCTCCCAGCTTCCCCGTGAGGG - Intronic
1183942317 22:41302473-41302495 GCCCCCTAGCACTCCCTGGACGG - Intronic
1183950434 22:41349552-41349574 CCCTCTCCGTGCTCCCTGGACGG - Intronic
1184538223 22:45101933-45101955 CCCCCCCACCTCACCCTAGAAGG - Intergenic
1184555803 22:45232596-45232618 CCATCCCAGCTCCCCCAGGACGG + Intronic
1185056461 22:48581265-48581287 GCCTCCCAGGCCTCCCTGCAAGG + Intronic
1185258227 22:49848428-49848450 CCCTCCCCGGTCCCCCAGGAAGG + Intergenic
1185300538 22:50077626-50077648 GCCTCACAGCTGGCCCTGGATGG - Intronic
950174298 3:10861844-10861866 CCCTCCCAGCTAACCCATGATGG - Intronic
950210047 3:11116558-11116580 ACCTCCCAGCGCTCCCCGCAGGG + Intergenic
950259606 3:11534724-11534746 CCCTCCCAGCGCAGCCTGGTAGG + Intronic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
950890630 3:16400940-16400962 CCCTCCCACCTCGCCCTGCCTGG + Intronic
952959321 3:38579741-38579763 CCCTCCCCAGACTCCCTGGAAGG + Intronic
953377630 3:42442132-42442154 CTCCCCCAGCTCACCATGGATGG + Intergenic
953699248 3:45183347-45183369 TCCACCCAGCTCTGCCTGCAAGG - Intergenic
954457464 3:50607599-50607621 CCCTTCCAGCTCTGACTGTACGG - Exonic
954538738 3:51380173-51380195 CCCCCCCAGCCCTCCCTGCCCGG + Exonic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
955317618 3:57951882-57951904 AGCCCCCAGCTCCCCCTGGATGG - Intergenic
955498396 3:59560525-59560547 CCCTCCCAGTTAGTCCTGGACGG - Intergenic
955503143 3:59604935-59604957 CCCTCCCAGCTCTCACTTATGGG - Intergenic
955918512 3:63930407-63930429 CCTCCACAGCTTTCCCTGGAAGG + Intronic
956084864 3:65597948-65597970 CGCCCCCAGCTCTCCCAGGAAGG - Intronic
957939722 3:86990455-86990477 CCTTCCCGGCTCTCTCGGGATGG + Intronic
961596934 3:128025348-128025370 CTCTCCCAGCTCTCCCAGCTAGG + Intergenic
962736516 3:138329949-138329971 CCCTCCTGCCTCTCCCTGGCTGG - Intergenic
963074826 3:141336137-141336159 CCCTCCCAACTTTACTTGGAAGG + Intronic
966864534 3:184249911-184249933 TCCTGCCAGCTCTACCTGGCGGG - Intronic
967977633 3:195044385-195044407 GCCACCTTGCTCTCCCTGGAGGG + Intergenic
968362539 3:198157486-198157508 CCCTCTCAGGTGTCCCTGTAGGG - Intergenic
968510280 4:992514-992536 CCCTCCCAGCTGGCCCTGATGGG - Intronic
969299774 4:6291111-6291133 CCCTGCCAACTCTGCCTGGAAGG - Intronic
969388549 4:6873469-6873491 CCCTCCTAGCTCTTCCTGAGAGG - Intronic
969921608 4:10545501-10545523 TCCACCCAGCTCTCCCAGGTTGG + Intronic
970373819 4:15435920-15435942 CTCTACCATCTCTTCCTGGAAGG - Exonic
973801536 4:54483300-54483322 CCCTCTCAGCACTCACTGCAAGG + Intergenic
978744259 4:112174209-112174231 CCCTCCCTGCACTCACTGTAGGG + Intronic
981031888 4:140134028-140134050 CTCTCCCATCTCTCCCTCCAGGG + Intronic
983513064 4:168629628-168629650 CCCTCCCATCCCTTCCTGGGTGG + Intronic
983546530 4:168970635-168970657 CCCTCCCACCCTTCCCTGCAAGG + Intronic
984314572 4:178111250-178111272 CCTTCCCAGCTCTTCTTGGATGG + Intergenic
984609489 4:181821305-181821327 CCCTCCCAGATTCCACTGGAAGG + Intergenic
985657684 5:1140525-1140547 TCCCCACAGCTGTCCCTGGAGGG + Intergenic
985975648 5:3417530-3417552 ACCATCCAGCTCGCCCTGGATGG - Intergenic
986208239 5:5646125-5646147 ACCTTCCAGCTCTGCCAGGAAGG - Intergenic
986752587 5:10802188-10802210 CCCTCCCATCTCTCACTGGGGGG + Intergenic
988455230 5:31381634-31381656 CCATCCCTCCTCTGCCTGGATGG + Intergenic
989075946 5:37563611-37563633 CCCCCCCACCTCCCCCCGGATGG + Intronic
990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG + Intergenic
995863990 5:116671540-116671562 CCCTCATTGCTCTCCCTGGGGGG - Intergenic
997206862 5:132055251-132055273 CCTTCCCCTCTCTCCCTGGGAGG + Intergenic
997998031 5:138602355-138602377 CCCTCCCATCTCTCCGTGCATGG + Intergenic
998071582 5:139202006-139202028 GGCTCCCTGCTCTCTCTGGATGG + Intronic
998403077 5:141858216-141858238 CACTCCCAGGCCTCTCTGGAGGG - Intronic
999144526 5:149383550-149383572 CCCTCCCCTCCCTCCCTGGTAGG + Intronic
999149999 5:149420586-149420608 CACACCCAGCTCTTTCTGGAGGG - Intergenic
1000114919 5:158144951-158144973 TCCTTCCAGATCACCCTGGAAGG + Intergenic
1001441083 5:171743530-171743552 CCCTCACAGCTCCTCCTGAAGGG + Intergenic
1001936636 5:175710105-175710127 CCCTCAGAGCTCTCCTTGGAAGG + Intergenic
1002076538 5:176711909-176711931 ATCCCCCAGCACTCCCTGGATGG - Intergenic
1002100160 5:176853644-176853666 CCCTCTCAGTGCTCCTTGGAAGG - Intronic
1002299656 5:178250091-178250113 CAATCCAAGCTCGCCCTGGAAGG + Exonic
1002338081 5:178494299-178494321 CCTTCCCATCTCTCCTAGGAAGG - Intronic
1002368052 5:178728955-178728977 CCCTCCCAGATCCCAGTGGATGG - Intronic
1002385274 5:178861093-178861115 CCCTCCCAGATCCCAGTGGATGG + Intronic
1002469180 5:179424763-179424785 CCACCCCAGCTCTCCTTGGGTGG - Intergenic
1002637228 5:180614427-180614449 CCCTCCCAGCTCTCAGGGGAGGG + Intronic
1003029911 6:2592950-2592972 CCCTGCCAGCTCACACTGGCTGG - Intergenic
1003149371 6:3535898-3535920 CTCTCCCAGCTCTGCCCAGAGGG - Intergenic
1003479062 6:6514482-6514504 CCCTTCCACTTCTCACTGGAAGG + Intergenic
1003497875 6:6679792-6679814 CCCTCCCTGCCCACCCTGGCAGG - Intergenic
1005016022 6:21376149-21376171 CCCTCTCAGCTTTGCATGGAAGG - Intergenic
1005399150 6:25413721-25413743 CCCTCCCACCTCCCCTGGGAAGG - Intronic
1006404659 6:33837993-33838015 CCCTCTCTCCTGTCCCTGGAGGG - Intergenic
1006509757 6:34515535-34515557 GCCTCCCTGCTGGCCCTGGATGG + Intronic
1006758827 6:36441555-36441577 CCCTCCCAGCACTTCCGGGCTGG - Intronic
1007093060 6:39196462-39196484 CTCACCCAGCCCTCCATGGAGGG + Intronic
1007775793 6:44223704-44223726 CCCTCCCTGCCCTCCGTGGCAGG - Exonic
1008797378 6:55320744-55320766 CTCTCCCAATTCTCCCTGGAAGG - Intergenic
1010805322 6:80228905-80228927 CAAGCCCAGCTCTCCCTGGAAGG - Intronic
1013480682 6:110550395-110550417 CCCACCTGGCTCTCCCGGGAAGG - Intergenic
1014358560 6:120444736-120444758 TGATCCCACCTCTCCCTGGATGG + Intergenic
1015693814 6:135957156-135957178 CTCTTCCAGCTCTGCCTGGCCGG - Intronic
1016025047 6:139278414-139278436 CCCTCCCAGCTCTCCAATTATGG + Intronic
1019134183 6:169897919-169897941 CCCGTCCAGCTCACCCTGGGTGG + Intergenic
1019253143 7:31221-31243 CCCTCTCAGGTGTCCCTGTAGGG + Intergenic
1019441546 7:1050015-1050037 CCCTCCCAGGTCTCTCTGGCGGG + Intronic
1019536656 7:1532943-1532965 CCCTCCCTGCTCTCCGCGAATGG + Intronic
1019777875 7:2923223-2923245 ACCTCCCAGCTCACCCTGCTGGG - Exonic
1020003036 7:4766361-4766383 TCTTCCCAGCACTGCCTGGAGGG - Exonic
1020100048 7:5389379-5389401 CCCTCCCACCCCTGCCTGGGCGG + Intronic
1021479930 7:21104612-21104634 CACTCCCAACTTTCCATGGATGG - Intergenic
1022097339 7:27148975-27148997 CCCTCCCTGCGGTCCCAGGAAGG - Intronic
1022643337 7:32208210-32208232 GCCTCCCAGCTCTTTTTGGAAGG - Intronic
1023347792 7:39289145-39289167 TCCTCCCAGCTGCCTCTGGAAGG + Intronic
1023492337 7:40757187-40757209 TCCTCCCTGCTCTCCTAGGAAGG - Intronic
1023628475 7:42139753-42139775 CCCTCCCAGGCGTCCCTGGCTGG - Intronic
1024257057 7:47547144-47547166 CCCTCCCTCCTCACCCTGGAGGG - Intronic
1025091014 7:56064396-56064418 CCTTCCCAGCGCCCCCAGGATGG - Intronic
1025251293 7:57353238-57353260 CCTTCCCCTCTCTCCCTGGTAGG - Intergenic
1025850014 7:65237620-65237642 CCCTCCCAGGCCTCCCAGGGTGG + Intergenic
1026232580 7:68498340-68498362 TCCTCCCAGCTCTCAGTGGATGG + Intergenic
1026895340 7:74007080-74007102 CCCTGACATCTCTCCATGGAGGG - Intergenic
1027757366 7:82231170-82231192 CCTTTCCAGCCTTCCCTGGAAGG - Intronic
1029371552 7:100154078-100154100 ACCTCCCACCCCTACCTGGACGG + Exonic
1029653878 7:101911781-101911803 CACCCCCAGCACTCGCTGGACGG - Intronic
1029896369 7:103989213-103989235 CCCTTCCAGCTCCCCGTGGTGGG + Exonic
1031980997 7:128124241-128124263 TCCTTCCAGCTCTCCCTTCATGG - Intergenic
1031987003 7:128169695-128169717 CCCTTTCTGCTCTTCCTGGAGGG - Intergenic
1032351132 7:131165073-131165095 CCATCCCCACTCTCCCTGGCTGG - Intronic
1035044716 7:155956101-155956123 CCCTCCCTGCTCTCCATGGTGGG + Intergenic
1035572679 8:683409-683431 CCCTCACGGCTGACCCTGGAGGG - Intronic
1038693813 8:29787120-29787142 CCCTCCCAACTCTCTCTCGCTGG + Intergenic
1039884578 8:41647758-41647780 CTCTCCCAGCTCTCCCAGCCGGG + Intronic
1040295349 8:46146124-46146146 CCCTTTCAGGTCTCCCTGAAAGG + Intergenic
1040436857 8:47399359-47399381 CCTTCCCAGCTGTCCGTGGATGG - Intronic
1040837563 8:51748398-51748420 CAATCCCAGCTCTCCCTCTAAGG - Intronic
1041183197 8:55270401-55270423 TCCTCCCCACTCTCCCAGGAAGG + Intronic
1041920719 8:63179852-63179874 CCCTCCCACCTCCCCCCGGATGG + Intronic
1042344945 8:67717823-67717845 CCCTCCTAGCTCTTCCTCCATGG - Intronic
1045500087 8:102738370-102738392 CCCAGCCACCTCTTCCTGGATGG - Intergenic
1048081037 8:131127334-131127356 CTCTCCCTACTCTCCCTGGGTGG - Intergenic
1049176173 8:141194011-141194033 CCCTCCCGTTTCTCCCTGGCAGG + Exonic
1049348588 8:142152175-142152197 TCCTTCCGGCTCTTCCTGGAGGG - Intergenic
1052833482 9:33233873-33233895 CCAGACCAGGTCTCCCTGGAGGG + Intronic
1052855179 9:33402521-33402543 GCCTCTCAGCTCTCCCAGGGCGG + Intergenic
1053382494 9:37660296-37660318 CCCTCCTAGATCTCCCTGCAAGG - Intronic
1054758534 9:68983315-68983337 CCCTCCCAAGTGTCCCTGGGTGG - Intronic
1055649011 9:78388933-78388955 CTCTCCCAGCCTTCCCCGGAAGG + Intergenic
1056178092 9:84055551-84055573 CCCTCTCAGTTCTCCCAGGTAGG + Intergenic
1056526590 9:87448186-87448208 CTCTCCCAACTCTCACTTGAAGG + Intergenic
1057303427 9:93899428-93899450 CACTCCCAGCTCCTCCTGAAGGG + Intergenic
1057801902 9:98195914-98195936 CCTTCCCTGCTCTTTCTGGAGGG - Intergenic
1058835351 9:108855005-108855027 CTCTTCCAGCCCTCCCTGGCAGG - Exonic
1058859105 9:109097070-109097092 CCTTCCCAGACCTCCCTGCATGG - Intronic
1059320977 9:113469259-113469281 CCCTGCCAGCTGCCCCTGGCTGG + Intronic
1061062988 9:128260042-128260064 GCCTCCCAGCCCTTCTTGGATGG + Intronic
1061237622 9:129351829-129351851 CCCTCCCGGCTCCCCCTTGCTGG + Intergenic
1061420270 9:130469831-130469853 CCCTCCCATCTCTCTCCTGATGG - Intronic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1061480690 9:130896465-130896487 CCCTGCCTGCTCTCAGTGGAGGG - Intergenic
1061726883 9:132587016-132587038 CTCTGCCCGCGCTCCCTGGAGGG - Intronic
1061849039 9:133403820-133403842 CCCACCCAGCTCACCCAGCAGGG - Exonic
1062028534 9:134351581-134351603 ACCTCCCTGCTCCCCCGGGAGGG + Intronic
1062060552 9:134493123-134493145 GGCTCCCAGCTCTCCCTCTAGGG - Intergenic
1062091561 9:134681153-134681175 CCACCCCAGCCCTCCCTGCAAGG - Intronic
1062161584 9:135083359-135083381 CCCTCCGCACTCTCCCTGGCAGG - Intronic
1062185932 9:135218501-135218523 CACTCCCAGCTGTCCCGGGCAGG - Intergenic
1062339164 9:136086298-136086320 CCCTCCCAGCTCTGAGTGGGAGG - Intronic
1062640248 9:137515062-137515084 CCCTTCCCGCCCTCCCTGCATGG - Intronic
1062747227 9:138221145-138221167 CCCTCTCAGGTGTCCCTGTAGGG - Intergenic
1186350187 X:8732189-8732211 CCCTCCCAGCTCGCCCTCGAGGG + Intergenic
1186588814 X:10906130-10906152 CACTCCCAGCTCTCCCTAAAGGG + Intergenic
1189798877 X:44673698-44673720 TCCTCCCTGAGCTCCCTGGAAGG + Intergenic
1190217387 X:48489028-48489050 CCCTCCCAGCTCACACTGACAGG - Intergenic
1191885211 X:65881171-65881193 TACTCCCAGCTCTGGCTGGAAGG - Intergenic
1192087954 X:68120051-68120073 CCTTCCCATCTCTCCCAAGAGGG + Intronic
1192200011 X:69060736-69060758 CTCTCCCAGCTCTCCCAGGAGGG - Intergenic
1192205081 X:69090252-69090274 CCTTCCCAGCTATGCCTGGAGGG - Intergenic
1192561677 X:72131684-72131706 CCCTCCGAGCTCGCCCCGGTGGG - Exonic
1192561869 X:72132508-72132530 CCCACCCAGCTCTCGGTGAATGG - Intergenic
1194424973 X:93725445-93725467 CCCTCCCAATTCTCCCAGGCTGG + Intergenic
1197887695 X:131235536-131235558 CCTTTCCACCTCTCTCTGGAGGG - Intergenic
1198370127 X:135982191-135982213 CTATCCCTGCACTCCCTGGATGG + Intergenic
1198688804 X:139257928-139257950 CCCTCCCACCTCTCACAGTAAGG - Intergenic
1198757955 X:140000826-140000848 CCCTCACAGCTTTCCTTGGCTGG - Intergenic
1201186748 Y:11412448-11412470 CCCTCTCTGCTCTTTCTGGATGG + Intergenic