ID: 1061424218

View in Genome Browser
Species Human (GRCh38)
Location 9:130489077-130489099
Sequence GCGTCTGAGGGCCCCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061424213_1061424218 -2 Left 1061424213 9:130489056-130489078 CCGAAACCCTGTCATTTTCTAGC 0: 1
1: 1
2: 0
3: 28
4: 255
Right 1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG No data
1061424214_1061424218 -8 Left 1061424214 9:130489062-130489084 CCCTGTCATTTTCTAGCGTCTGA 0: 1
1: 0
2: 0
3: 21
4: 147
Right 1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG No data
1061424215_1061424218 -9 Left 1061424215 9:130489063-130489085 CCTGTCATTTTCTAGCGTCTGAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061424218 Original CRISPR GCGTCTGAGGGCCCCTTCAA AGG Intronic
No off target data available for this crispr