ID: 1061424301

View in Genome Browser
Species Human (GRCh38)
Location 9:130489578-130489600
Sequence TCTCACATGAGGATGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 191}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061424301_1061424306 -7 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424306 9:130489594-130489616 TGTGAGACCCCAAAAGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 160
1061424301_1061424308 0 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424308 9:130489601-130489623 CCCCAAAAGGTGCAGGCCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1061424301_1061424310 1 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424310 9:130489602-130489624 CCCAAAAGGTGCAGGCCAAAGGG 0: 1
1: 0
2: 2
3: 7
4: 146
1061424301_1061424319 28 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424319 9:130489629-130489651 GAGGGAAAGTGCAGGGCATGAGG 0: 1
1: 0
2: 4
3: 47
4: 500
1061424301_1061424317 20 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424317 9:130489621-130489643 AGGGGGTTGAGGGAAAGTGCAGG 0: 1
1: 0
2: 4
3: 56
4: 791
1061424301_1061424312 2 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424312 9:130489603-130489625 CCAAAAGGTGCAGGCCAAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 235
1061424301_1061424315 10 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424315 9:130489611-130489633 TGCAGGCCAAAGGGGGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 198
1061424301_1061424320 29 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424320 9:130489630-130489652 AGGGAAAGTGCAGGGCATGAGGG 0: 1
1: 0
2: 1
3: 42
4: 578
1061424301_1061424314 9 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424314 9:130489610-130489632 GTGCAGGCCAAAGGGGGTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 211
1061424301_1061424313 3 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424313 9:130489604-130489626 CAAAAGGTGCAGGCCAAAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 177
1061424301_1061424318 21 Left 1061424301 9:130489578-130489600 CCCACTGCCATCCTCATGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1061424318 9:130489622-130489644 GGGGGTTGAGGGAAAGTGCAGGG 0: 1
1: 0
2: 9
3: 69
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061424301 Original CRISPR TCTCACATGAGGATGGCAGT GGG (reversed) Intronic
900893587 1:5467171-5467193 CCTCACATGGGGCTGGCAGATGG - Intergenic
900951686 1:5861658-5861680 TCCCACAGGAGGATGGAGGTTGG - Intergenic
903007338 1:20307364-20307386 TCTCTCATGGGGATGGCCCTGGG + Intronic
903384226 1:22916246-22916268 CCCCACATGGGGCTGGCAGTCGG + Intergenic
904855732 1:33497018-33497040 TGTCATAAGAGGATGGCAGGAGG - Intergenic
905249828 1:36640809-36640831 TTTCACAAGAGGAAGGCAGGAGG - Intergenic
906787616 1:48629702-48629724 TCTCTCATGGGAATGGGAGTGGG + Intronic
908057837 1:60310134-60310156 TCTCAGATGAGTATAGCAGGAGG - Intergenic
912147411 1:106810075-106810097 AGTCACATGTGGATGGCAGCAGG - Intergenic
912506243 1:110158485-110158507 TCTCACATGAAGGTGGTAGCTGG + Intronic
917745556 1:178003272-178003294 TGTGAGATGAGGCTGGCAGTGGG - Intergenic
920319482 1:205107722-205107744 GATCACCTGAGGTTGGCAGTTGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1063614472 10:7590018-7590040 TCACAGATGACGATGGTAGTTGG - Intronic
1064685810 10:17860029-17860051 TCTCACTTGAGGCAGGGAGTTGG - Intronic
1064861841 10:19835165-19835187 TCTCCCATGAAGTTGACAGTTGG + Intronic
1066302338 10:34108156-34108178 TCTCAGATGAGGATGGAGGTAGG - Intergenic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067564499 10:47326843-47326865 TCTCCCATGAGGTTGTCACTGGG - Intergenic
1067984050 10:51122128-51122150 TATTAAATGAGGATGGCATTTGG + Intronic
1070338302 10:75474421-75474443 TCTCACTTTAGCATGGCAGAAGG + Intronic
1070345636 10:75538856-75538878 TATCACATGAGGCTAGCAGAAGG - Intronic
1070483886 10:76911539-76911561 TCTCTCATGAGGCTGTCAGGAGG + Intronic
1072082775 10:92048330-92048352 TCTCACACAAGGACAGCAGTTGG + Intronic
1072758908 10:98039921-98039943 TCTCTCAGGAGGATGGCACATGG - Intergenic
1074622572 10:115140731-115140753 TCTCATATAAGGATTGAAGTTGG + Intronic
1076539188 10:131203584-131203606 TCTCCCATGAGGATGAATGTGGG + Intronic
1078479999 11:11667433-11667455 TCTTACAAGAGGAAGGCAGAGGG - Intergenic
1080861589 11:36154784-36154806 TCTCAAATGAGGCTGTCATTAGG - Intronic
1081198086 11:40185779-40185801 TCTTGCATGAGGATGGGAGGAGG + Intronic
1082672415 11:56051795-56051817 TCTTACATTAAGGTGGCAGTAGG - Intergenic
1082909665 11:58356372-58356394 TCTCTCATGTGGGTGGCTGTTGG + Intergenic
1083418214 11:62538970-62538992 TCAAACAGGAGGATGGCTGTCGG - Intronic
1084175295 11:67419645-67419667 TCTCACCTGAGCAGGGCAGCTGG - Exonic
1084460186 11:69292840-69292862 GCTCCCAGGAAGATGGCAGTGGG - Intergenic
1085011825 11:73146620-73146642 TCTCACATCAGGCTGGCAGGAGG - Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1089398117 11:118149056-118149078 CCCCAGATGAGGATGGCAGGGGG - Intronic
1096121761 12:49093181-49093203 TGTAAAATGAGGGTGGCAGTGGG + Intronic
1099380562 12:81947145-81947167 TGGGAAATGAGGATGGCAGTGGG - Intergenic
1100472857 12:94909105-94909127 GCTCAGATGAGGATGGCATGTGG - Intronic
1102185382 12:110943606-110943628 CCTCAAATGAGAAGGGCAGTGGG + Intergenic
1104419656 12:128624889-128624911 CTTCACATGAGGGTGGCACTGGG - Intronic
1105061324 12:133153802-133153824 TCTAAAATGAAGATGTCAGTGGG + Intronic
1105884899 13:24633497-24633519 TCTCACATGAGGAGGGGTTTTGG - Intergenic
1110755096 13:79163355-79163377 TCTAACATTTGAATGGCAGTTGG - Intergenic
1111322982 13:86654786-86654808 TCTGAGATGAGGATGGATGTGGG - Intergenic
1111551568 13:89819169-89819191 TCCCACATGAGGAATCCAGTGGG + Intergenic
1112153514 13:96791597-96791619 TCTCACATGAGAATGACAATGGG - Intronic
1112870445 13:103964406-103964428 AATCACATGAAGATTGCAGTTGG + Intergenic
1114602482 14:23967853-23967875 TCTCACATCAGAATGGCTTTGGG - Intronic
1114606851 14:24004979-24005001 TCTCACATCAGAATGGCTTTGGG - Intronic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121720613 14:96106088-96106110 TCTCACAGGAGGATGGGAAGAGG - Intergenic
1122046950 14:99030549-99030571 TCTCCCATGGGGATGACAGCTGG - Intergenic
1125803957 15:42476461-42476483 ACTAAAGTGAGGATGGCAGTAGG - Intronic
1127256309 15:57296664-57296686 TCTCACATGCAGAAGGCAATGGG + Intronic
1127457799 15:59170940-59170962 TCTCACATGAACATGGAATTGGG - Intronic
1128314524 15:66652316-66652338 TCTCACATCTCTATGGCAGTAGG + Intronic
1128387158 15:67157961-67157983 TCTCTCATCAGGAAGCCAGTGGG + Intronic
1131268831 15:90934533-90934555 TCTCACCTGAGGATGGGCGGGGG - Intronic
1132016886 15:98325588-98325610 TCTCATGTGAGGATGGCCCTGGG + Intergenic
1132122942 15:99193481-99193503 TGTCATATGTGGATGGCAGCAGG - Intronic
1133497051 16:6328679-6328701 TCTCTCATGAGGATGGCAATAGG + Intronic
1134572568 16:15303856-15303878 TCTCACATGACGGAGGAAGTGGG - Intergenic
1134729814 16:16452166-16452188 TCTCACATGACGGAGGAAGTGGG + Intergenic
1134788850 16:16970071-16970093 TCTTATAAGAGGATGGCAGGAGG + Intergenic
1134887433 16:17806155-17806177 TTTCCCAGGAGGAAGGCAGTTGG - Intergenic
1134937617 16:18259730-18259752 TCTCACATGACGGAGGAAGTGGG - Intergenic
1139436345 16:66938809-66938831 TTTCTCATGAGAAGGGCAGTGGG - Intronic
1140131627 16:72166957-72166979 TCTCACATCTGGTTAGCAGTAGG + Intronic
1141589410 16:85057910-85057932 TCACCAATGAGGAGGGCAGTGGG - Intronic
1144864736 17:18328122-18328144 TCTCACACCAGGATGGGACTGGG + Exonic
1145769060 17:27479350-27479372 ACTCACATAAGATTGGCAGTGGG - Intronic
1150049085 17:61941212-61941234 TATCACCTGAGGTTGGGAGTTGG - Intergenic
1150281326 17:63931141-63931163 TGTCTGATGAGGATGACAGTGGG + Intronic
1150861750 17:68807454-68807476 TCTCACTTGGGATTGGCAGTTGG + Intergenic
1152391172 17:80004894-80004916 GATCACTTGAGGTTGGCAGTTGG - Intronic
1153108512 18:1556818-1556840 ATTCACATGATGTTGGCAGTAGG + Intergenic
1153241162 18:3032625-3032647 GATCACCTGAGGACGGCAGTTGG - Intergenic
1156596920 18:38558111-38558133 TCTCCCATAATGATGGCAGAGGG + Intergenic
1157737473 18:50062874-50062896 TCTTACCTGATGATGGGAGTGGG - Intronic
1159118877 18:64146530-64146552 TCTCACTTGGGGATGACCGTTGG - Intergenic
1160172834 18:76568717-76568739 TTTCAAATGAGGAGGGGAGTGGG + Intergenic
1164388553 19:27796266-27796288 TCAGACATGAGGGTGGCAGGTGG + Intergenic
1166001076 19:39877811-39877833 TGGCACATGAGCATGGCAGGTGG + Exonic
1166003857 19:39894070-39894092 TGGCACATGAGCATGGCAGGTGG + Exonic
1166843803 19:45714002-45714024 GCTCACCTGAGCATGGCAGTGGG - Intronic
1168315901 19:55484730-55484752 TCTCACACGAGGGGGGCAGCGGG - Intergenic
924965412 2:72241-72263 CCTCACAAGAGGATGGCAGGAGG + Intergenic
925182985 2:1829120-1829142 TCTCCCATGAAGATGGCGTTGGG + Intronic
925198878 2:1950418-1950440 TGTCCCATGAGGTTGGGAGTAGG - Intronic
925666725 2:6264677-6264699 AGCCACATGAGGATGGCAGAGGG + Intergenic
926329158 2:11810576-11810598 TCTCCCCTTAGGATGGCAGATGG + Intronic
926433308 2:12813060-12813082 TCACACATTAGGAAGGCACTAGG - Intergenic
926763694 2:16303591-16303613 TCTCAAATTAGCATGTCAGTGGG + Intergenic
927208329 2:20623951-20623973 TCTCACAGGCGGCTGGCAGCAGG + Exonic
927896936 2:26788894-26788916 GATCACTTGAGGTTGGCAGTTGG - Intronic
928040642 2:27873011-27873033 ACACACATGAGGAGGGCAGTGGG + Intronic
928436362 2:31257151-31257173 GCTCACAGCAGGAGGGCAGTAGG - Intronic
928740504 2:34346738-34346760 TATCACCTGAGGCTGGGAGTTGG - Intergenic
929006592 2:37399601-37399623 TTTTACATGAGGATATCAGTTGG + Intergenic
929941401 2:46336638-46336660 CCTCAGATTAGGATGGCAGCAGG + Intronic
930861845 2:56082496-56082518 TCTAACATGAGGACAGTAGTAGG + Intergenic
935743009 2:106167445-106167467 ACACACAAGAGGATGGCAATGGG - Intronic
937485499 2:122310867-122310889 TCTCCCATCACGATGTCAGTTGG + Intergenic
937485893 2:122314459-122314481 TCTCCCATCACGATGTCAGTTGG - Intergenic
940292748 2:152093733-152093755 TCACACATGTGGTTGGCAGTTGG - Intronic
941997235 2:171612097-171612119 TCTCACAGCAGCAGGGCAGTGGG - Intergenic
943704582 2:191021277-191021299 TCTCACAAGAGGCTGGAGGTTGG - Intergenic
944851100 2:203720023-203720045 ACTTCCATGAGAATGGCAGTGGG - Intronic
948486221 2:238282975-238282997 TCACACCTGAGGCTGGCACTGGG + Intronic
1170778083 20:19396866-19396888 TCACACATGAGGTTGGCAAGTGG - Intronic
1172084200 20:32366619-32366641 TCTCAGTGGAGGGTGGCAGTGGG + Intronic
1172196916 20:33098139-33098161 TGCCACAGGGGGATGGCAGTAGG + Intronic
1173526622 20:43737892-43737914 GATCACCTGAGGTTGGCAGTTGG - Intergenic
1173872231 20:46349293-46349315 TCTCAAATGAGGAAGGGAGGGGG - Intronic
1174057654 20:47809735-47809757 TCTCATAAGAGGATGGCCCTGGG + Intergenic
1176378657 21:6100672-6100694 TGGCACAAGAGGCTGGCAGTGGG - Intergenic
1177335631 21:19722247-19722269 AATCACATGAGGCTGGGAGTTGG + Intergenic
1179744818 21:43437565-43437587 TGGCACAAGAGGCTGGCAGTGGG + Intergenic
1180883463 22:19223197-19223219 TCCCAGATGATGATGGCACTTGG + Intronic
1182003171 22:26937730-26937752 TCAGACATGAGGTTGGGAGTAGG - Intergenic
949663766 3:6313254-6313276 TCTGAAATAAAGATGGCAGTAGG + Intergenic
955335259 3:58080224-58080246 TATCACATGGGGAGGGAAGTTGG + Intronic
956035374 3:65084993-65085015 TCCCACATGTGAATGGCTGTGGG - Intergenic
959355477 3:105322577-105322599 TTTCTCATGAGGATGGGAGTGGG - Intergenic
960940477 3:122929829-122929851 TCTCACATGCCCATGGCATTAGG + Intronic
962775318 3:138653664-138653686 ACTCAGCTGAGGATGGGAGTTGG - Exonic
963246367 3:143067498-143067520 TCACCCATGATGATGGGAGTGGG - Intergenic
963298609 3:143574636-143574658 TCTCTCCTGGGGATGGAAGTAGG + Intronic
964287083 3:155129882-155129904 TCTCACATGAGGTTGCTGGTTGG - Intronic
967528105 3:190517302-190517324 ACTAGCATGAGGATGGCAGAGGG - Intronic
968438743 4:610660-610682 CCTCTCATGAGGCTGGCAGCTGG - Intergenic
969007078 4:4028877-4028899 TCACACATGTGCCTGGCAGTTGG - Intergenic
971098697 4:23437811-23437833 TCTCACCTGAGGATTGCAAAAGG - Intergenic
971459472 4:26878957-26878979 CCACACATGAGGATTACAGTTGG + Intronic
972089449 4:35262170-35262192 TCTCCAAAGAGGATGGCATTTGG - Intergenic
972108345 4:35523154-35523176 TCTCACAAAAGGATTTCAGTGGG - Intergenic
973059470 4:45702961-45702983 TGTGAAATGAGGATTGCAGTGGG + Intergenic
973719508 4:53708752-53708774 TATCCCATGATGGTGGCAGTAGG - Intronic
974752796 4:66163445-66163467 TCTCACATTGAGATGGCACTTGG - Intergenic
975394021 4:73853893-73853915 ACTCACATGAGTTGGGCAGTGGG - Exonic
976947854 4:90792513-90792535 TCTTCCAGGAGGATGGCAGAAGG + Intronic
979606391 4:122643215-122643237 TCTTAATTGGGGATGGCAGTGGG + Intergenic
983541334 4:168913997-168914019 TCTGACATGAGGATGGCCTGAGG - Exonic
984983441 4:185304576-185304598 GATCACATGAGGCTGGGAGTTGG - Intronic
985561592 5:589528-589550 TCTCAAATGAGTTTGGCAGGAGG + Intergenic
985931309 5:3059711-3059733 CCTCACAGGAGGATGGCACTGGG + Intergenic
986824349 5:11504664-11504686 TCTCCAATGTGGATGGCTGTGGG + Intronic
992055398 5:72983993-72984015 TCTCAAATAAGGATGGAAGGTGG - Intronic
998180494 5:139935736-139935758 GATCACTTGAGGCTGGCAGTTGG + Intronic
998952945 5:147410468-147410490 CCTTACATGGGGATAGCAGTGGG + Intronic
1002471338 5:179437942-179437964 TCTCACATGAGCCTGGGGGTGGG + Intergenic
1010540766 6:77089296-77089318 TGTCACATTAGGATGTTAGTGGG + Intergenic
1011552060 6:88538984-88539006 TCTCCCATGAGGATTGGAGTGGG - Intergenic
1011662446 6:89606137-89606159 TCACAGGTGAGGATGGCTGTGGG + Intronic
1013115935 6:107103725-107103747 GATCACCTGAGGATGGGAGTTGG + Intronic
1015910736 6:138165459-138165481 TCTCCCATGAGGGTCTCAGTGGG - Intronic
1015910776 6:138165605-138165627 TCTCCCATGAGGGTCTCAGTGGG - Intronic
1016086624 6:139922614-139922636 GCTCACATGATTATGGCAGCTGG - Intergenic
1016593610 6:145773773-145773795 GCTGACATGAAGATGCCAGTTGG + Intergenic
1017411032 6:154168203-154168225 TCTGAGATGAGGGTGCCAGTGGG - Intronic
1017733588 6:157339806-157339828 TCTCTCACCAGGATGACAGTAGG + Intergenic
1019108659 6:169691445-169691467 TGTAACTTGAGCATGGCAGTAGG + Intronic
1019140407 6:169938891-169938913 GCTCACATGGGGTTTGCAGTGGG + Intergenic
1022377406 7:29827577-29827599 TCTCACATTATGATCTCAGTAGG - Intronic
1023722126 7:43107087-43107109 TGTCAGATGAGGATGGCAGCTGG - Intergenic
1024001906 7:45195272-45195294 TCTCCCTTCAGGATGTCAGTTGG + Intergenic
1024532966 7:50408484-50408506 TCTCACTTGAGGATTACAGAAGG + Intergenic
1026230908 7:68483264-68483286 TCTCTCCTGAGGATGAGAGTTGG + Intergenic
1026391755 7:69910123-69910145 TCTCAGATAAACATGGCAGTAGG + Intronic
1026525141 7:71146717-71146739 TCTGACATGTGGATGACAATCGG + Intronic
1031700007 7:124913025-124913047 CATCTCATGTGGATGGCAGTAGG + Intronic
1035031950 7:155866496-155866518 TTTCACTTGGGGCTGGCAGTGGG - Intergenic
1035729122 8:1842270-1842292 TTTCCAATGAGGATGGCAGTGGG - Intronic
1041162721 8:55061372-55061394 TCTCACCTTAGCATGGTAGTAGG + Intergenic
1041669658 8:60479657-60479679 TGTCAACTGAGGATGCCAGTGGG - Intergenic
1042458132 8:69029327-69029349 TCTGAAATCAAGATGGCAGTAGG - Intergenic
1042657800 8:71119574-71119596 TCTCCCCTGAGGATAGGAGTGGG - Intergenic
1044361223 8:91286485-91286507 TCTCAAAAGAGGATGGCTGAGGG - Intronic
1044368255 8:91376758-91376780 TCTCACGGGAGGATGGCAAGGGG + Intronic
1045491741 8:102675390-102675412 GCTCAGATGAGGAAGGCAGGTGG + Intergenic
1045735873 8:105296067-105296089 TCTTACATGATGGTGGCAGAGGG + Intronic
1045765629 8:105664553-105664575 GATCACCTGAGGATGGGAGTTGG - Intronic
1052825515 9:33171266-33171288 TCACTCATGTGAATGGCAGTTGG + Intergenic
1053308268 9:36999387-36999409 CCTCTGATGAGGAGGGCAGTGGG - Intronic
1055642231 9:78328583-78328605 CCTCACATGAGAATAGCAGCAGG + Intronic
1057085906 9:92209797-92209819 TCTGACATGAGGAGTGTAGTTGG + Intergenic
1057879232 9:98780559-98780581 TCTCTCATGAGGAAGGCAGGGGG + Intronic
1057919839 9:99088017-99088039 TCTCACATGGAGATGGCATGAGG + Intergenic
1061410719 9:130419875-130419897 TCCCACATTTGGTTGGCAGTGGG - Intronic
1061424301 9:130489578-130489600 TCTCACATGAGGATGGCAGTGGG - Intronic
1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG + Intronic
1186809297 X:13171777-13171799 ACTCACCTGAGGATGGAGGTGGG + Intergenic
1186899389 X:14037496-14037518 TATCACCTGAGGTTGGGAGTTGG + Intergenic
1188595359 X:31893619-31893641 TCTCAGATGAGGATGCCTGGTGG + Intronic
1189217195 X:39336388-39336410 TGTAACATGGAGATGGCAGTGGG + Intergenic
1191029930 X:55958911-55958933 TCACACATGTGCATGTCAGTGGG - Intergenic
1192050053 X:67716568-67716590 AGTAAGATGAGGATGGCAGTAGG + Intronic
1192172641 X:68866462-68866484 TCCCAACTGAGGAGGGCAGTAGG + Intergenic
1192731051 X:73803013-73803035 TCTTACAGGCGGATGGCAGTTGG + Intergenic
1195849600 X:109268880-109268902 TTTCACAAGAGGATGTCAGGGGG + Intergenic
1196854799 X:119972793-119972815 TTTCTGGTGAGGATGGCAGTGGG + Intergenic
1196857258 X:119995837-119995859 TATCTGGTGAGGATGGCAGTGGG + Intergenic
1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG + Intergenic
1199761431 X:150907210-150907232 TCTCTCATTTGGATGTCAGTGGG + Intergenic
1202012888 Y:20367532-20367554 TATCACATGAGGTCAGCAGTTGG + Intergenic