ID: 1061425779

View in Genome Browser
Species Human (GRCh38)
Location 9:130497642-130497664
Sequence CCCTCTTTGCAGGGGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061425768_1061425779 16 Left 1061425768 9:130497603-130497625 CCAGCAGCCTCGTGGGACAAGTT 0: 1
1: 1
2: 0
3: 2
4: 83
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data
1061425769_1061425779 9 Left 1061425769 9:130497610-130497632 CCTCGTGGGACAAGTTTGTCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data
1061425773_1061425779 -10 Left 1061425773 9:130497629-130497651 CCCTGGATGTGGGCCCTCTTTGC 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data
1061425767_1061425779 17 Left 1061425767 9:130497602-130497624 CCCAGCAGCCTCGTGGGACAAGT 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data
1061425764_1061425779 29 Left 1061425764 9:130497590-130497612 CCTCTTGGAACTCCCAGCAGCCT 0: 1
1: 0
2: 2
3: 10
4: 227
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data
1061425763_1061425779 30 Left 1061425763 9:130497589-130497611 CCCTCTTGGAACTCCCAGCAGCC 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061425779 Original CRISPR CCCTCTTTGCAGGGGCTGCC AGG Intronic
No off target data available for this crispr