ID: 1061430240

View in Genome Browser
Species Human (GRCh38)
Location 9:130526296-130526318
Sequence TCCCGATGCCACAGCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061430240_1061430247 5 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430247 9:130526324-130526346 ACTGAGGCTGCCTGGCCGAGGGG No data
1061430240_1061430245 3 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430245 9:130526322-130526344 AGACTGAGGCTGCCTGGCCGAGG No data
1061430240_1061430248 11 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430248 9:130526330-130526352 GCTGCCTGGCCGAGGGGAAGTGG No data
1061430240_1061430253 25 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430253 9:130526344-130526366 GGGAAGTGGGATGGTGACAGTGG No data
1061430240_1061430244 -3 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430244 9:130526316-130526338 GGAGGGAGACTGAGGCTGCCTGG No data
1061430240_1061430246 4 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430246 9:130526323-130526345 GACTGAGGCTGCCTGGCCGAGGG No data
1061430240_1061430249 12 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430249 9:130526331-130526353 CTGCCTGGCCGAGGGGAAGTGGG No data
1061430240_1061430251 16 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061430240 Original CRISPR TCCCGATGCCACAGCCCTCC TGG (reversed) Intergenic
No off target data available for this crispr