ID: 1061430251

View in Genome Browser
Species Human (GRCh38)
Location 9:130526335-130526357
Sequence CTGGCCGAGGGGAAGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061430234_1061430251 26 Left 1061430234 9:130526286-130526308 CCTGCAGACCCCAGGAGGGCTGT No data
Right 1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG No data
1061430238_1061430251 17 Left 1061430238 9:130526295-130526317 CCCAGGAGGGCTGTGGCATCGGG No data
Right 1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG No data
1061430240_1061430251 16 Left 1061430240 9:130526296-130526318 CCAGGAGGGCTGTGGCATCGGGA No data
Right 1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG No data
1061430236_1061430251 18 Left 1061430236 9:130526294-130526316 CCCCAGGAGGGCTGTGGCATCGG No data
Right 1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061430251 Original CRISPR CTGGCCGAGGGGAAGTGGGA TGG Intergenic
No off target data available for this crispr