ID: 1061431250

View in Genome Browser
Species Human (GRCh38)
Location 9:130532766-130532788
Sequence CGGATCACACAGGTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061431236_1061431250 22 Left 1061431236 9:130532721-130532743 CCCCCTGGGGGAAAAGAGGCGGG No data
Right 1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG No data
1061431239_1061431250 20 Left 1061431239 9:130532723-130532745 CCCTGGGGGAAAAGAGGCGGGAT No data
Right 1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG No data
1061431240_1061431250 19 Left 1061431240 9:130532724-130532746 CCTGGGGGAAAAGAGGCGGGATG No data
Right 1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG No data
1061431238_1061431250 21 Left 1061431238 9:130532722-130532744 CCCCTGGGGGAAAAGAGGCGGGA No data
Right 1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061431250 Original CRISPR CGGATCACACAGGTCCCTGA GGG Intergenic