ID: 1061436765

View in Genome Browser
Species Human (GRCh38)
Location 9:130568180-130568202
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061436765_1061436771 13 Left 1061436765 9:130568180-130568202 CCACCAGGGGCCTGGTAGTCAAG No data
Right 1061436771 9:130568216-130568238 TAATTTAAGATAGTGGGGTTTGG No data
1061436765_1061436768 6 Left 1061436765 9:130568180-130568202 CCACCAGGGGCCTGGTAGTCAAG No data
Right 1061436768 9:130568209-130568231 AGAGTAGTAATTTAAGATAGTGG No data
1061436765_1061436770 8 Left 1061436765 9:130568180-130568202 CCACCAGGGGCCTGGTAGTCAAG No data
Right 1061436770 9:130568211-130568233 AGTAGTAATTTAAGATAGTGGGG No data
1061436765_1061436769 7 Left 1061436765 9:130568180-130568202 CCACCAGGGGCCTGGTAGTCAAG No data
Right 1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061436765 Original CRISPR CTTGACTACCAGGCCCCTGG TGG (reversed) Intergenic
No off target data available for this crispr