ID: 1061436769

View in Genome Browser
Species Human (GRCh38)
Location 9:130568210-130568232
Sequence GAGTAGTAATTTAAGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061436765_1061436769 7 Left 1061436765 9:130568180-130568202 CCACCAGGGGCCTGGTAGTCAAG No data
Right 1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG No data
1061436766_1061436769 4 Left 1061436766 9:130568183-130568205 CCAGGGGCCTGGTAGTCAAGAGA No data
Right 1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG No data
1061436767_1061436769 -3 Left 1061436767 9:130568190-130568212 CCTGGTAGTCAAGAGAATGAGAG No data
Right 1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061436769 Original CRISPR GAGTAGTAATTTAAGATAGT GGG Intergenic
No off target data available for this crispr