ID: 1061440806

View in Genome Browser
Species Human (GRCh38)
Location 9:130602218-130602240
Sequence ATGGCTTCAGCCACCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061440799_1061440806 24 Left 1061440799 9:130602171-130602193 CCAATGTATAGGAAAAAATGTAG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1061440806 9:130602218-130602240 ATGGCTTCAGCCACCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061440806 Original CRISPR ATGGCTTCAGCCACCTACCA GGG Intronic
No off target data available for this crispr