ID: 1061443063

View in Genome Browser
Species Human (GRCh38)
Location 9:130619934-130619956
Sequence CTCATGGACCTGCCCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061443060_1061443063 -4 Left 1061443060 9:130619915-130619937 CCTTGGCAAAGTTCTCTGTCTCA 0: 1
1: 0
2: 0
3: 23
4: 268
Right 1061443063 9:130619934-130619956 CTCATGGACCTGCCCTCAGTGGG No data
1061443059_1061443063 12 Left 1061443059 9:130619899-130619921 CCTCTGTGTTGTAAAGCCTTGGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1061443063 9:130619934-130619956 CTCATGGACCTGCCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061443063 Original CRISPR CTCATGGACCTGCCCTCAGT GGG Intronic
No off target data available for this crispr