ID: 1061446354

View in Genome Browser
Species Human (GRCh38)
Location 9:130640415-130640437
Sequence AGTGGGGCTGGGAGAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446354_1061446365 1 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446365 9:130640439-130640461 CTGGTCCACTAGGGCCCAGCTGG No data
1061446354_1061446367 3 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446354_1061446361 -8 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446361 9:130640430-130640452 GCCCCACTTCTGGTCCACTAGGG No data
1061446354_1061446372 17 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446354_1061446360 -9 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446360 9:130640429-130640451 AGCCCCACTTCTGGTCCACTAGG No data
1061446354_1061446373 30 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446354_1061446366 2 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446366 9:130640440-130640462 TGGTCCACTAGGGCCCAGCTGGG No data
1061446354_1061446371 16 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446371 9:130640454-130640476 CCAGCTGGGGTTTTTTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446354 Original CRISPR AGTGGGGCTGGGAGAGAGTG GGG (reversed) Intergenic
No off target data available for this crispr