ID: 1061446356

View in Genome Browser
Species Human (GRCh38)
Location 9:130640417-130640439
Sequence GAAGTGGGGCTGGGAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446356_1061446361 -10 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446361 9:130640430-130640452 GCCCCACTTCTGGTCCACTAGGG No data
1061446356_1061446366 0 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446366 9:130640440-130640462 TGGTCCACTAGGGCCCAGCTGGG No data
1061446356_1061446374 29 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446374 9:130640469-130640491 TAAGATGGGCTGAAGCAAATGGG No data
1061446356_1061446367 1 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446356_1061446371 14 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446371 9:130640454-130640476 CCAGCTGGGGTTTTTTAAGATGG No data
1061446356_1061446373 28 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446356_1061446372 15 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446356_1061446365 -1 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446365 9:130640439-130640461 CTGGTCCACTAGGGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446356 Original CRISPR GAAGTGGGGCTGGGAGAGAG TGG (reversed) Intergenic
No off target data available for this crispr