ID: 1061446358

View in Genome Browser
Species Human (GRCh38)
Location 9:130640426-130640448
Sequence AGTGGACCAGAAGTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446358_1061446372 6 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446358_1061446366 -9 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446366 9:130640440-130640462 TGGTCCACTAGGGCCCAGCTGGG No data
1061446358_1061446365 -10 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446365 9:130640439-130640461 CTGGTCCACTAGGGCCCAGCTGG No data
1061446358_1061446367 -8 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446358_1061446374 20 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446374 9:130640469-130640491 TAAGATGGGCTGAAGCAAATGGG No data
1061446358_1061446371 5 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446371 9:130640454-130640476 CCAGCTGGGGTTTTTTAAGATGG No data
1061446358_1061446373 19 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446358 Original CRISPR AGTGGACCAGAAGTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr