ID: 1061446363

View in Genome Browser
Species Human (GRCh38)
Location 9:130640432-130640454
Sequence GGCCCTAGTGGACCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446363_1061446373 13 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446363_1061446374 14 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446374 9:130640469-130640491 TAAGATGGGCTGAAGCAAATGGG No data
1061446363_1061446372 0 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446363_1061446371 -1 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446371 9:130640454-130640476 CCAGCTGGGGTTTTTTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446363 Original CRISPR GGCCCTAGTGGACCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr