ID: 1061446367

View in Genome Browser
Species Human (GRCh38)
Location 9:130640441-130640463
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446355_1061446367 2 Left 1061446355 9:130640416-130640438 CCCACTCTCTCCCAGCCCCACTT No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446356_1061446367 1 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446359_1061446367 -9 Left 1061446359 9:130640427-130640449 CCAGCCCCACTTCTGGTCCACTA No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446353_1061446367 26 Left 1061446353 9:130640392-130640414 CCGCAGCTTCTAGCTGGCTACAG No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446354_1061446367 3 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data
1061446358_1061446367 -8 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446367 9:130640441-130640463 GGTCCACTAGGGCCCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446367 Original CRISPR GGTCCACTAGGGCCCAGCTG GGG Intergenic