ID: 1061446368

View in Genome Browser
Species Human (GRCh38)
Location 9:130640444-130640466
Sequence AAACCCCAGCTGGGCCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446368_1061446373 1 Left 1061446368 9:130640444-130640466 CCACTAGGGCCCAGCTGGGGTTT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446368_1061446374 2 Left 1061446368 9:130640444-130640466 CCACTAGGGCCCAGCTGGGGTTT No data
Right 1061446374 9:130640469-130640491 TAAGATGGGCTGAAGCAAATGGG No data
1061446368_1061446376 28 Left 1061446368 9:130640444-130640466 CCACTAGGGCCCAGCTGGGGTTT No data
Right 1061446376 9:130640495-130640517 GATAGATGCTTAGAGATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446368 Original CRISPR AAACCCCAGCTGGGCCCTAG TGG (reversed) Intergenic
No off target data available for this crispr