ID: 1061446369

View in Genome Browser
Species Human (GRCh38)
Location 9:130640453-130640475
Sequence CATCTTAAAAAACCCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446369_1061446373 -8 Left 1061446369 9:130640453-130640475 CCCAGCTGGGGTTTTTTAAGATG No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446369_1061446377 30 Left 1061446369 9:130640453-130640475 CCCAGCTGGGGTTTTTTAAGATG No data
Right 1061446377 9:130640506-130640528 AGAGATTAATGGCCAGAAAGTGG No data
1061446369_1061446376 19 Left 1061446369 9:130640453-130640475 CCCAGCTGGGGTTTTTTAAGATG No data
Right 1061446376 9:130640495-130640517 GATAGATGCTTAGAGATTAATGG No data
1061446369_1061446374 -7 Left 1061446369 9:130640453-130640475 CCCAGCTGGGGTTTTTTAAGATG No data
Right 1061446374 9:130640469-130640491 TAAGATGGGCTGAAGCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446369 Original CRISPR CATCTTAAAAAACCCCAGCT GGG (reversed) Intergenic
No off target data available for this crispr