ID: 1061446372

View in Genome Browser
Species Human (GRCh38)
Location 9:130640455-130640477
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446362_1061446372 1 Left 1061446362 9:130640431-130640453 CCCCACTTCTGGTCCACTAGGGC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446354_1061446372 17 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446363_1061446372 0 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446356_1061446372 15 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446359_1061446372 5 Left 1061446359 9:130640427-130640449 CCAGCCCCACTTCTGGTCCACTA No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446358_1061446372 6 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446364_1061446372 -1 Left 1061446364 9:130640433-130640455 CCACTTCTGGTCCACTAGGGCCC No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data
1061446355_1061446372 16 Left 1061446355 9:130640416-130640438 CCCACTCTCTCCCAGCCCCACTT No data
Right 1061446372 9:130640455-130640477 CAGCTGGGGTTTTTTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446372 Original CRISPR CAGCTGGGGTTTTTTAAGAT GGG Intergenic