ID: 1061446373

View in Genome Browser
Species Human (GRCh38)
Location 9:130640468-130640490
Sequence TTAAGATGGGCTGAAGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061446359_1061446373 18 Left 1061446359 9:130640427-130640449 CCAGCCCCACTTCTGGTCCACTA No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446368_1061446373 1 Left 1061446368 9:130640444-130640466 CCACTAGGGCCCAGCTGGGGTTT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446364_1061446373 12 Left 1061446364 9:130640433-130640455 CCACTTCTGGTCCACTAGGGCCC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446362_1061446373 14 Left 1061446362 9:130640431-130640453 CCCCACTTCTGGTCCACTAGGGC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446354_1061446373 30 Left 1061446354 9:130640415-130640437 CCCCACTCTCTCCCAGCCCCACT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446370_1061446373 -9 Left 1061446370 9:130640454-130640476 CCAGCTGGGGTTTTTTAAGATGG No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446358_1061446373 19 Left 1061446358 9:130640426-130640448 CCCAGCCCCACTTCTGGTCCACT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446356_1061446373 28 Left 1061446356 9:130640417-130640439 CCACTCTCTCCCAGCCCCACTTC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446363_1061446373 13 Left 1061446363 9:130640432-130640454 CCCACTTCTGGTCCACTAGGGCC No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446369_1061446373 -8 Left 1061446369 9:130640453-130640475 CCCAGCTGGGGTTTTTTAAGATG No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data
1061446355_1061446373 29 Left 1061446355 9:130640416-130640438 CCCACTCTCTCCCAGCCCCACTT No data
Right 1061446373 9:130640468-130640490 TTAAGATGGGCTGAAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061446373 Original CRISPR TTAAGATGGGCTGAAGCAAA TGG Intergenic
No off target data available for this crispr